MirGeneDB

MirGeneDB ID

Bta-Mir-148-P1

Family name MIR-148 (all species)
Seed CAGUGCA
Species Cow (Bos taurus)
MiRBase ID bta-mir-148a
Paralogues Bta-Mir-148-P2  Bta-Mir-148-P3 
Orthologues Aca-Mir-148-P1  Cfa-Mir-148-P1  Cli-Mir-148-P1  Cli-Mir-148-P1-as  Cpi-Mir-148-P1  Cpo-Mir-148-P1  Dno-Mir-148-P1  Ete-Mir-148-P1  Gga-Mir-148-P1  Hsa-Mir-148-P1  Mdo-Mir-148-P1  Mml-Mir-148-P1  Mmu-Mir-148-P1  Oan-Mir-148-P1  Ocu-Mir-148-P1  Rno-Mir-148-P1  Sto-Mir-148-P1  Tgu-Mir-148-P1  Tgu-Mir-148-P1-as  Xtr-Mir-148-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr4: 70414256-70414315 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGGAGGAGGACAGUUUGGUCUUUUGAGGCAAAGUUCUGAGACACUCCGACUCUGAAUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUCUAGGGACUGUGGUCGUCGUCGCCGCCG
Get precursor sequence
Structure
        10          20        30         40         50         
CUGGAGGAGGACAGUUU--       U              -  A-|   CC    CUGAAU 
                   GGUCUUU GAGGCAAAGUUCUG AG  CACU  GACU      A
                   UCAGGGA CUCUGUUUCAAGAC UC  GUGA  CUGA      U
GCCGCCGCUGCUGCUGGUG       U              A  AC^   --    AGAUAG 
.       110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-148-P1_5p*

MirBase accessionNone
Sequence
0- AAAGUUCUGAGACACUCCGACU -22
Get sequence
Mature sequence

Bta-Mir-148-P1_3p

MirBase accessionMIMAT0003522
Sequence
38- UCAGUGCACUACAGAACUUUGU -60
Get sequence
Validated targets TargetScanVert: bta-miR-148a