MirGeneDB

MirGeneDB ID

Aca-Mir-148-P1

Family name MIR-148 (all species)
Seed CAGUGCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-148a
Paralogues Aca-Mir-148-P3 
Orthologues Bta-Mir-148-P1  Cfa-Mir-148-P1  Cli-Mir-148-P1  Cli-Mir-148-P1-as  Cpi-Mir-148-P1  Cpo-Mir-148-P1  Dno-Mir-148-P1  Ete-Mir-148-P1  Gga-Mir-148-P1  Hsa-Mir-148-P1  Mdo-Mir-148-P1  Mml-Mir-148-P1  Mmu-Mir-148-P1  Oan-Mir-148-P1  Ocu-Mir-148-P1  Rno-Mir-148-P1  Sto-Mir-148-P1  Tgu-Mir-148-P1  Tgu-Mir-148-P1-as  Xtr-Mir-148-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
6: 31781720-31781779 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGAAAAAGCAGAUUUGGUCUCUGGAAGCAAAGUUCUGUGACACUCGGACUCUGAUUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCGCCGGGGGCCGUGGCAGCCAAGGAGUUAA
Get precursor sequence
Structure
        10          20        30        40          50         
GAGGAAAAAGCAGAUUU--         AA             A--|   CG    CUGAUU 
                   GGUCUCUGG  GCAAAGUUCUGUG   CACU  GACU      A
                   CCGGGGGCC  UGUUUCAAGACAU   GUGA  CUGA      U
AAUUGAGGAACCGACGGUG         GC             CAC^   --    AGAUAG 
.       110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-148-P1_5p*

MirBase accessionMIMAT0021780
Sequence
0- AAAGUUCUGUGACACUCGGACU -22
Get sequence
Mature sequence

Aca-Mir-148-P1_3p

MirBase accessionMIMAT0021781
Sequence
38- UCAGUGCACUACAGAACUUUGU -60
Get sequence