MirGeneDB

MirGeneDB ID

Aca-Mir-499

Family name MIR-499 (all species)
Seed UAAGACU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-499
Paralogues
Orthologues Ami-Mir-499  Bta-Mir-499  Cfa-Mir-499  Cli-Mir-499  Cpi-Mir-499  Cpo-Mir-499  Dno-Mir-499  Dre-Mir-499  Ete-Mir-499  Gga-Mir-499  Hsa-Mir-499  Mdo-Mir-499  Mml-Mir-499  Mmu-Mir-499  Oan-Mir-499  Ocu-Mir-499  Rno-Mir-499  Sha-Mir-499  Sto-Mir-499  Tgu-Mir-499  Xtr-Mir-499 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
4: 135451083-135451142 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCUUCUCUGUUACUUGAGGGGGAGGCAGUUAAGACUUGCAGUGAUGUUUAGAAAAUUUACUACAUGAACAUCACUUUAAGUCUGUGCUACUUCUUUCCUUAUCUUGACUGCGGGAAGG
Get precursor sequence
Structure
        10         20         30        40        50         
CUGCUUCUCUGUUACUU-    -|     C   UA       C           GAAAAU 
                  GAGG GGGAGG AGU  AGACUUG AGUGAUGUUUA      U
                  UUCC UUCUUC UCG  UCUGAAU UCACUACAAGU      U
GGAAGGGCGUCAGUUCUA    U^     A   UG       U           ACAUCA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-499_5p

MirBase accessionMIMAT0021980
Sequence
0- UUAAGACUUGCAGUGAUGUUUA -22
Get sequence
Star sequence

Aca-Mir-499_3p*

MirBase accessionMIMAT0021981
Sequence
38- AACAUCACUUUAAGUCUGUGCU -60
Get sequence