MirGeneDB

MirGeneDB ID

Sto-Mir-1788

Family name MIR-1788 (all species)
Seed AGGCAGC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-1788  Ami-Mir-1788  Cli-Mir-1788  Cpi-Mir-1788  Dre-Mir-1788  Gga-Mir-1788  Tgu-Mir-1788  Xtr-Mir-1788 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01085147.1: 745-807 [+]
Precursor
(pre-Mir +30nt flank)
UCUCUGUAAGAGCUGCUCUCCCAGGUUCCUGGCUUGUUUCGAGUUGCCUGCGUUUGUUUGUUUUUGGGGACACAGGCAGCUAAAGCAAGCCUGGAAACUGCGAGGAAACGGCGCCAGAGGAAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
UCUCUGUAAGAGCUGCU--|  C   G    U         CG         C UUUGUUUG 
                   CUC CAG UUCC GGCUUGUUU  AGUUGCCUG G        U
                   GAG GUC AAGG CCGAACGAA  UCGACGGAC C        U
UAAGGAGACCGCGGCAAAG^  C   A    U         A-         A AGGGGUUU 
 120       110       100        90         80        70
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-1788_5p* (predicted)

MirBase accessionNone
Sequence
0- GGCUUGUUUCGAGUUGCCUGCG -22
Get sequence
Mature sequence

Sto-Mir-1788_3p (predicted)

MirBase accessionNone
Sequence
42- CAGGCAGCUAAAGCAAGCCUG -63
Get sequence