MirGeneDB

MirGeneDB ID

Aca-Mir-1788

Family name MIR-1788 (all species)
Seed GCUUGUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1788
Paralogues
Orthologues Ami-Mir-1788  Cli-Mir-1788  Cpi-Mir-1788  Dre-Mir-1788  Gga-Mir-1788  Sto-Mir-1788  Tgu-Mir-1788  Xtr-Mir-1788 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 87812135-87812194 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUCUGCAUCAUGUAACCUCCCUGUGCUGGGCUUGUUUUCAGUUGCCUGCGGCUGAUUAAUAGGGACUCAGGCAGCUAAAGCAAGUCUGAUACAUGAAAGGAGAACCAGCAGAAUCCUU
Get precursor sequence
Structure
        10         20         30        40        50          
ACCUCUGCAUCAUGUAA-   CCC-|   CU           C         CGGCUGAUU 
                  CCU    UGUG  GGGCUUGUUUU AGUUGCCUG         \
                  GGA    ACAU  UCUGAACGAAA UCGACGGAC         A
UUCCUAAGACGACCAAGA   AAGU^   AG           -         UCAGGGAUA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1788_5p

MirBase accessionMIMAT0021805
Sequence
0- GGCUUGUUUUCAGUUGCCUGCG -22
Get sequence
Co-mature sequence

Aca-Mir-1788_3p

MirBase accessionMIMAT0021806
Sequence
39- CAGGCAGCUAAAGCAAGUCUG -60
Get sequence