MirGeneDB

MirGeneDB ID

Sto-Mir-128-P2

Family name MIR-128 (all species)
Seed CACAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-128-P1  Sto-Mir-128-P3 
Orthologues Aca-Mir-128-P2  Ami-Mir-128-P2  Bta-Mir-128-P2  Cfa-Mir-128-P2  Cli-Mir-128-P2  Cpi-Mir-128-P2  Cpo-Mir-128-P2  Dno-Mir-128-P2  Dre-Mir-128-P2  Ete-Mir-128-P2  Gga-Mir-128-P2  Hsa-Mir-128-P2  Mdo-Mir-128-P2  Mml-Mir-128-P2  Mmu-Mir-128-P2  Oan-Mir-128-P2  Ocu-Mir-128-P2  Rno-Mir-128-P2  Sha-Mir-128-P2  Tgu-Mir-128-P2  Xtr-Mir-128-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01008602.1: 113193-113250 [-]
Precursor
(pre-Mir +30nt flank)
UCAUUGGAAACAGCACCAAGCAUCUGGAGAGGGGGCCGUUACACUGUAAGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUUUCAGAAGCCACACAUUCAUCGUCCAAAAU
Get precursor sequence
Structure
        10          20        30        40        50         
UCAUUGGAAACAGCACCAA--| A                UUA      AA    GUGAG 
                     GC UCUGGAGAGGGGGCCG   CACUGU  GAGA     U
                     CG AGACUUUUUCUCUGGC   GUGACA  CUCU     A
UAAAACCUGCUACUUACACAC^ A                CAA      --    GGACG 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-128-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- GGGGGCCGUUACACUGUAAGAGA -23
Get sequence
Mature sequence

Sto-Mir-128-P2_3p

MirBase accessionNone
Sequence
37- UCACAGUGAACCGGUCUCUUU -58
Get sequence