MirGeneDB

MirGeneDB ID

Sto-Mir-128-P1

Family name MIR-128 (all species)
Seed CACAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-128-P2  Sto-Mir-128-P3 
Orthologues Aca-Mir-128-P1  Ami-Mir-128-P1  Bta-Mir-128-P1  Cfa-Mir-128-P1  Cli-Mir-128-P1  Cpi-Mir-128-P1  Cpo-Mir-128-P1  Dno-Mir-128-P1  Dre-Mir-128-P1a  Dre-Mir-128-P1b  Ete-Mir-128-P1  Gga-Mir-128-P1  Hsa-Mir-128-P1  Mdo-Mir-128-P1  Mml-Mir-128-P1  Mmu-Mir-128-P1  Oan-Mir-128-P1  Ocu-Mir-128-P1  Rno-Mir-128-P1  Sha-Mir-128-P1  Tgu-Mir-128-P1  Xtr-Mir-128-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002217.1: 155517-155572 [+]
Precursor
(pre-Mir +30nt flank)
AUAAUCAGCAUUUCUGUGAGCUGUUGAAUACGGGGCCGGAACACUGUCUGAGAGUACUAGAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUCCUUAACUGCGGAGCAAAA
Get precursor sequence
Structure
        10          20        30        40        50       
AUAAUCAGCAUUUCUGU--|   U      UAC        AA      CU  GAGUA 
                   GAGC GUUGAA   GGGGCCGG  CACUGU  GA     C
                   UUCG CGACUU   CUCUGGCC  GUGACA  CU     U
AAAACGAGGCGUCAAUUCC^   U      UUU        AA      CU  UUAGA 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-128-P1_5p*

MirBase accessionNone
Sequence
0- CGGGGCCGGAACACUGUCUGA -21
Get sequence
Mature sequence

Sto-Mir-128-P1_3p

MirBase accessionNone
Sequence
35- UCACAGUGAACCGGUCUCUUU -56
Get sequence