MirGeneDB

MirGeneDB ID

Cfa-Mir-128-P1

Family name MIR-128 (all species)
Seed CACAGUG
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-128-1
Paralogues Cfa-Mir-128-P2 
Orthologues Aca-Mir-128-P1  Ami-Mir-128-P1  Bta-Mir-128-P1  Cli-Mir-128-P1  Cpi-Mir-128-P1  Cpo-Mir-128-P1  Dno-Mir-128-P1  Dre-Mir-128-P1a  Dre-Mir-128-P1b  Ete-Mir-128-P1  Gga-Mir-128-P1  Hsa-Mir-128-P1  Mdo-Mir-128-P1  Mml-Mir-128-P1  Mmu-Mir-128-P1  Oan-Mir-128-P1  Ocu-Mir-128-P1  Rno-Mir-128-P1  Sha-Mir-128-P1  Sto-Mir-128-P1  Tgu-Mir-128-P1  Xtr-Mir-128-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(canFam3)
chr19: 38435956-38436011 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUUGGCCUUGUUCCUGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUCCUGGCUUCUUUUUACUCA
Get precursor sequence
Structure
        10          20        30        40        50        
UAAUUGGCCUUGUUCCU--|   U      UUC       UAG      CU    GGUU 
                   GAGC GUUGGA   GGGGCCG   CACUGU  GAGA    U
                   UUCG CGACUU   CUCUGGC   GUGACA  CUCU    A
ACUCAUUUUUCUUCGGUCC^   U      UUU       CAA      --    UUAC 
    110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Star sequence

Cfa-Mir-128-P1_5p*

MirBase accessionNone
Sequence
0- CGGGGCCGUAGCACUGUCUGAGA -23
Get sequence
Mature sequence

Cfa-Mir-128-P1_3p

MirBase accessionMIMAT0006633
Sequence
35- UCACAGUGAACCGGUCUCUUU -56
Get sequence
Validated targets TargetScanVert: cfa-miR-128
miRDB: MIMAT0006633