MirGeneDB

MirGeneDB ID

Sha-Mir-128-P1

Family name MIR-128 (all species)
Seed CACAGUG
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID sha-mir-128
Paralogues Sha-Mir-128-P2 
Orthologues Aca-Mir-128-P1  Ami-Mir-128-P1  Bta-Mir-128-P1  Cfa-Mir-128-P1  Cli-Mir-128-P1  Cpi-Mir-128-P1  Cpo-Mir-128-P1  Dno-Mir-128-P1  Dre-Mir-128-P1a  Dre-Mir-128-P1b  Ete-Mir-128-P1  Gga-Mir-128-P1  Hsa-Mir-128-P1  Mdo-Mir-128-P1  Mml-Mir-128-P1  Mmu-Mir-128-P1  Oan-Mir-128-P1  Ocu-Mir-128-P1  Rno-Mir-128-P1  Sto-Mir-128-P1  Tgu-Mir-128-P1  Xtr-Mir-128-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL849609.1: 2503941-2503996 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUUGGCCUUAUUUGUGAGCUGUUGGAUUCGGGGCCGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUCCUGGCUUCUUUUUACUCA
Get precursor sequence
Structure
        10          20        30        40        50        
UAAUUGGCCUUAUUUGU--|   U      UUC       UAG      CU    GGUU 
                   GAGC GUUGGA   GGGGCCG   CACUGU  GAGA    U
                   UUCG CGACUU   CUCUGGC   GUGACA  CUCU    A
ACUCAUUUUUCUUCGGUCC^   U      UUU       CAA      --    UUAC 
    110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-128-P1_5p*

MirBase accessionNone
Sequence
0- CGGGGCCGUAGCACUGUCUGAGA -23
Get sequence
Mature sequence

Sha-Mir-128-P1_3p

MirBase accessionMIMAT0022798
Sequence
35- UCACAGUGAACCGGUCUCUUU -56
Get sequence