MirGeneDB

MirGeneDB ID

Sto-Mir-128-P3

Family name MIR-128 (all species)
Seed CACAGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-128-P1  Sto-Mir-128-P2 
Orthologues
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001094.1: 33025-33082 [-]
Precursor
(pre-Mir +30nt flank)
UGGUGCAGGCAACCCCAGGGUUAUUGGAAAGGGGACCGUUGCACUGUAGGAGAAGGAGUAGCAGGUCUCACAGUGAACCGGUCUCUGUUCCAGAACUCUCAUCUUCAAGUGCCAACUC
Get precursor sequence
Structure
        10           20        30        40        50        
UGGUGCAGGCAACCCCA---|    A      A        UUG      AG  GAAGGA 
                    GGGUU UUGGAA GGGGACCG   CACUGU  GA      G
                    CUCAA GACCUU UCUCUGGC   GUGACA  CU      U
CUCAACCGUGAACUUCUACU^    -      G        CAA      CU  GGACGA 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-128-P3_5p*

MirBase accessionNone
Sequence
0- GGGGACCGUUGCACUGUAGGA -21
Get sequence
Mature sequence

Sto-Mir-128-P3_3p

MirBase accessionNone
Sequence
37- UCACAGUGAACCGGUCUCUGU -58
Get sequence