MirGeneDB

MirGeneDB ID

Mmu-Mir-128-P2

Family name MIR-128 (all species)
Seed CACAGUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-128-2
Paralogues Mmu-Mir-128-P1 
Orthologues Aca-Mir-128-P2  Ami-Mir-128-P2  Bta-Mir-128-P2  Cfa-Mir-128-P2  Cli-Mir-128-P2  Cpi-Mir-128-P2  Cpo-Mir-128-P2  Dno-Mir-128-P2  Dre-Mir-128-P2  Ete-Mir-128-P2  Gga-Mir-128-P2  Hsa-Mir-128-P2  Mdo-Mir-128-P2  Mml-Mir-128-P2  Oan-Mir-128-P2  Ocu-Mir-128-P2  Rno-Mir-128-P2  Sha-Mir-128-P2  Sto-Mir-128-P2  Tgu-Mir-128-P2  Xtr-Mir-128-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr9: 112118644-112118701 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCCCCGGCAGCCACUGUGCAGUGGGAAGGGGGGCCGAUGCACUGUAAGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUCCCUACUGUGUCAAACUCCUAAGGAAUGCC
Get precursor sequence
Structure
        10          20        30        40        50         
GAGCCCCGGCAGCCACU--|UG       A          AUG      AA    GUGAG 
                   G  CAGUGGG AGGGGGGCCG   CACUGU  GAGA     U
                   U  GUCAUCC UUUCUCUGGC   GUGACA  CUCU     A
CCGUAAGGAAUCCUCAAAC^GU       C          CAA      --    GGACG 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-128-P2_5p*

MirBase accessionMIMAT0017069
Sequence
0- GGGGGCCGAUGCACUGUAAGAGA -23
Get sequence
Validated targets TargetScanVert: mmu-miR-128-2-5p
miRDB: MIMAT0017069
Mature sequence

Mmu-Mir-128-P2_3p

MirBase accessionMIMAT0000140
Sequence
37- UCACAGUGAACCGGUCUCUUU -58
Get sequence
Validated targets microrna.org: MIMAT0000140
TargetScanVert: mmu-miR-128-3p
miRDB: MIMAT0000140