MirGeneDB

MirGeneDB ID

Aca-Mir-128-P2

Family name MIR-128 (all species)
Seed CACAGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-128-1
Paralogues Aca-Mir-128-P1 
Orthologues Ami-Mir-128-P2  Bta-Mir-128-P2  Cfa-Mir-128-P2  Cli-Mir-128-P2  Cpi-Mir-128-P2  Cpo-Mir-128-P2  Dno-Mir-128-P2  Dre-Mir-128-P2  Ete-Mir-128-P2  Gga-Mir-128-P2  Hsa-Mir-128-P2  Mdo-Mir-128-P2  Mml-Mir-128-P2  Mmu-Mir-128-P2  Oan-Mir-128-P2  Ocu-Mir-128-P2  Rno-Mir-128-P2  Sha-Mir-128-P2  Sto-Mir-128-P2  Tgu-Mir-128-P2  Xtr-Mir-128-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
6: 42720755-42720812 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAUUCCCCGCAGCAAUGUACAGUUGGAAGGGGGGCCGUUACACUGUAAGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUUCCUACUGUGUCACAUCUCUCCUAAUUGCA
Get precursor sequence
Structure
        10          20        30        40        50         
AGAUUCCCCGCAGCAAU- -|     U             UUA      AA    GUGAG 
                  G UACAGU GGAAGGGGGGCCG   CACUGU  GAGA     U
                  C GUGUCA CCUUUUCUCUGGC   GUGACA  CUCU     A
ACGUUAAUCCUCUCUACA U^     U             CAA      --    GGACG 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-128-P2_5p*

MirBase accessionMIMAT0021732
Sequence
0- GGGGGCCGUUACACUGUAAGAGA -23
Get sequence
Mature sequence

Aca-Mir-128-P2_3p

MirBase accessionMIMAT0021733
Sequence
37- UCACAGUGAACCGGUCUCUUU -58
Get sequence