MirGeneDB

MirGeneDB ID

Spu-Mir-31

Family name MIR-31 (all species)
Seed GGCAAGA
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-31
Paralogues
Orthologues Aae-Mir-31  Aca-Mir-31  Ami-Mir-31  Asu-Mir-31  Bfl-Mir-31  Bge-Mir-31  Bta-Mir-31  Cel-Mir-31  Cfa-Mir-31  Cgi-Mir-31  Cin-Mir-31  Cli-Mir-31  Cpi-Mir-31  Cpo-Mir-31  Cte-Mir-31  Dan-Mir-31-P1  Dan-Mir-31-P2  Dme-Mir-31-P1  Dme-Mir-31-P2  Dmo-Mir-31-P1  Dmo-Mir-31-P2  Dno-Mir-31  Dpu-Mir-31  Dre-Mir-31  Efe-Mir-31  Ete-Mir-31  Gga-Mir-31  Hme-Mir-31  Hsa-Mir-31  Lan-Mir-31-P6  Lan-Mir-31-P7  Lgi-Mir-31  Mdo-Mir-31  Mml-Mir-31  Mmu-Mir-31  Oan-Mir-31  Ocu-Mir-31  Pfl-Mir-31  Pmi-Mir-31-P3  Pmi-Mir-31-P4  Pmi-Mir-31-P5a  Pmi-Mir-31-P5b  Rno-Mir-31  Sha-Mir-31  Sko-Mir-31  Sto-Mir-31  Tca-Mir-31  Tgu-Mir-31  Xtr-Mir-31 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold97: 60329-60391 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUUUACCUGGUACAAACCAGUGGAGAAAAGGCAAGAUGUUGGCAUAGCUGUGAUUUAAAUAUUAACCCAGCUGUGUCUUCAUACUGCCAUUUAUUCACUUGGUUGUUCGCCCAGAAUCUUG
Get precursor sequence
Structure
        10         20         30        40        50        60 
UCAUUUACCUGGUACAA-   -|     G   A    AG   UU          UGAUUUAA 
                  ACC AGUGGA AAA GGCA  AUG  GGCAUAGCUG        \
                  UGG UCACUU UUU CCGU  UAC  CUGUGUCGAC        A
GUUCUAAGACCCGCUUGU   U^     A   A    CA   UU          CCAAUUAU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-31_5p

MirBase accessionMIMAT0009657
Sequence
0- AGGCAAGAUGUUGGCAUAGCUGU -23
Get sequence
Star sequence

Spu-Mir-31_3p*

MirBase accessionNone
Sequence
40- AGCUGUGUCUUCAUACUGCCAUU -63
Get sequence