MirGeneDB

MirGeneDB ID

Rno-Mir-337

Family name MIR-337 (all species)
Seed GGCGUCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-337
Paralogues Rno-Mir-337-as 
Orthologues Cpo-Mir-337-v1  Cpo-Mir-337-v2  Dno-Mir-337-v1  Dno-Mir-337-v2  Hsa-Mir-337-as  Hsa-Mir-337-v1  Hsa-Mir-337-v2  Mml-Mir-337-as  Mml-Mir-337-v1  Mml-Mir-337-v2  Mmu-Mir-337  Mmu-Mir-337-as  Ocu-Mir-337-as  Ocu-Mir-337-v1  Ocu-Mir-337-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133705948-133706001 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-337)
Mir-493 chr6: 133699522-133699583 [+] UCSC Ensembl
Mir-337-as chr6: 133705943-133706003 [-] UCSC Ensembl
Mir-337 chr6: 133705948-133706001 [+] UCSC Ensembl
Mir-540 chr6: 133706216-133706274 [+] UCSC Ensembl
Mir-431 chr6: 133711444-133711508 [+] UCSC Ensembl
Mir-433 chr6: 133712345-133712418 [+] UCSC Ensembl
Mir-127 chr6: 133713452-133713507 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAGUGUAGUGAGAAGUUGGGGGGUGGGAACGGCGUCAUGCAGGAGUUGAUUGCACAGCCAUUCAGCUCCUAUAUGAUGCCUUUCUUCACCCCCUUCAACCGCGUGUGGCGUCC
Get precursor sequence
Structure
        10         20         30        40        50      
CCAGUGUAGUGAGAAGUU-        -|   C         C         UUGCA 
                   GGGGGGUG GGAA GGCGUCAUG AGGAGUUGA     C
                   UCCCCCAC UCUU CCGUAGUAU UCCUCGACU     A
CCUGCGGUGUGCGCCAACU        U^   U         A         UACCG 
  110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThe Drosha site in murids is shifted +3 and the gene is arm switched relative to the other eutherians.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-337_5p

MirBase accessionMIMAT0017035
Sequence
0- CGGCGUCAUGCAGGAGUUGAUU -22
Get sequence
Validated targets TargetScanVert: rno-miR-337-5p
miRDB: MIMAT0017035
Star sequence

Rno-Mir-337_3p*

MirBase accessionMIMAT0000577
Sequence
32- UCAGCUCCUAUAUGAUGCCUUU -54
Get sequence
Validated targets microrna.org: MIMAT0000577
TargetScanVert: rno-miR-337-3p
miRDB: MIMAT0000577