MirGeneDB

MirGeneDB ID

Rno-Mir-136-v1

Family name MIR-136 (all species)
Seed AUCAUCG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-136
Paralogues Rno-Mir-136-v2 
Orthologues Bta-Mir-136-v1  Cfa-Mir-136-v1  Cpo-Mir-136-v1  Dno-Mir-136-v1  Ete-Mir-136-v1  Hsa-Mir-136-v1  Mml-Mir-136-v1  Mmu-Mir-136-v1  Ocu-Mir-136-v1 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133716775-133716830 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-136-v1)
Mir-431 chr6: 133711444-133711508 [+] UCSC Ensembl
Mir-433 chr6: 133712345-133712418 [+] UCSC Ensembl
Mir-127 chr6: 133713452-133713507 [+] UCSC Ensembl
Mir-136-v1 chr6: 133716775-133716830 [+] UCSC Ensembl
Mir-136-v2 chr6: 133716775-133716830 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUUCAACGGUGUUGGAUGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAAGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCUAUCAUGUCGUCGGUUGGA
Get precursor sequence
Structure
        10          20        30        40        50        
CUUCAACGGUGUUGGAU--|       G        C     UUU          UUCU 
                   GAGCCCUC GAGGACUC AUUUG   UGAUGAUGGA    \
                   CUUGGGAG CUUCUGAG UAAAC   GCUACUACCU    U
AGGUUGGCUGCUGUACUAU^       A        -     UCU          CGAA 
    110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-136-v1_5p*

MirBase accessionMIMAT0000842
Sequence
0- ACUCCAUUUGUUUUGAUGAUGGA -23
Get sequence
Validated targets microrna.org: MIMAT0000842
TargetScanVert: rno-miR-136-5p
miRDB: MIMAT0000842
Mature sequence

Rno-Mir-136-v1_3p

MirBase accessionMIMAT0004733
Sequence
34- CAUCAUCGUCUCAAAUGAGUCU -56
Get sequence
Validated targets microrna.org: MIMAT0004733
TargetScanVert: rno-miR-136-3p
miRDB: MIMAT0004733