MirGeneDB

MirGeneDB ID

Rno-Mir-139

Family name MIR-139 (all species)
Seed CUACAGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-139
Paralogues
Orthologues Aca-Mir-139  Ami-Mir-139  Bta-Mir-139  Cfa-Mir-139  Cli-Mir-139  Cpi-Mir-139  Cpo-Mir-139  Dno-Mir-139  Dre-Mir-139  Ete-Mir-139  Hsa-Mir-139  Mdo-Mir-139  Mml-Mir-139  Mmu-Mir-139  Oan-Mir-139  Ocu-Mir-139  Sha-Mir-139  Sto-Mir-139  Tgu-Mir-139  Xtr-Mir-139 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(rn6)
chr1: 166589551-166589609 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGGGGGCGCCAGGACAGGCGCAGGUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUUGGAGUAACAACUGAAGCCAGAGUCUUCGAAGGGUG
Get precursor sequence
Structure
        10        20          30         40        50         
UGGGGGGCGCCAGGACAG  G-   G  -      -|   U  A            GUGGC 
                  GC  CAG UG UAUUCU ACAG GC CGUGUCUCCAGU     \
                  CG  GUC AC AUGAGG UGUC CG GCGCAGAGGUCG     U
GUGGGAAGCUUCUGAGAC  AA   A  A      U^   C  -            GAGGC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-139_5p

MirBase accessionMIMAT0000845
Sequence
0- UCUACAGUGCACGUGUCUCCAGU -23
Get sequence
Validated targets microrna.org: MIMAT0000845
TargetScanVert: rno-miR-139-5p
miRDB: MIMAT0000845
Star sequence

Rno-Mir-139_3p*

MirBase accessionMIMAT0004735
Sequence
36- UGGAGACGCGGCCCUGUUGGAGU -59
Get sequence
Validated targets microrna.org: MIMAT0004735
TargetScanVert: rno-miR-139-3p
miRDB: MIMAT0004735