MirGeneDB

MirGeneDB ID

Aca-Mir-139

Family name MIR-139 (all species)
Seed CUACAGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-139
Paralogues
Orthologues Ami-Mir-139  Bta-Mir-139  Cfa-Mir-139  Cli-Mir-139  Cpi-Mir-139  Cpo-Mir-139  Dno-Mir-139  Dre-Mir-139  Ete-Mir-139  Hsa-Mir-139  Mdo-Mir-139  Mml-Mir-139  Mmu-Mir-139  Oan-Mir-139  Ocu-Mir-139  Rno-Mir-139  Sha-Mir-139  Sto-Mir-139  Tgu-Mir-139  Xtr-Mir-139 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
GL343695.1: 186505-186563 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCAGCCAAAGAAGGAGGGCCUGGCUGUAUUCUACAGUGCAUGUGUCUCCAGUGUUUUCCAGCGACUGGAGAUACGGCCCUGUUGGAAUAACAGCCAGAGCCAAGAGCAGCAUCGGAGG
Get precursor sequence
Structure
        10        20          30         40        50         
UGCAGCCAAAGAAGGAGG  -       -      -|   U  A            GUUUU 
                  GC CUGGCUG UAUUCU ACAG GC UGUGUCUCCAGU     \
                  CG GACCGAC AUAAGG UGUC CG GCAUAGAGGUCA     C
GGAGGCUACGACGAGAAC  A       A      U^   C  -            GCGAC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-139_5p

MirBase accessionMIMAT0021762
Sequence
0- UCUACAGUGCAUGUGUCUCCAGU -23
Get sequence
Star sequence

Aca-Mir-139_3p*

MirBase accessionMIMAT0021763
Sequence
36- UGGAGAUACGGCCCUGUUGGAAU -59
Get sequence