MirGeneDB

MirGeneDB ID

Mmu-Mir-431

Family name MIR-431 (all species)
Seed GUCUUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-431
Paralogues
Orthologues Bta-Mir-431  Cfa-Mir-431  Cpo-Mir-431  Ete-Mir-431  Hsa-Mir-431  Mml-Mir-431  Rno-Mir-431 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109590459-109590523 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-431)
Mir-337-as chr12: 109585813-109585873 [-] UCSC Ensembl
Mir-337 chr12: 109585818-109585871 [+] UCSC Ensembl
Mir-540 chr12: 109586085-109586143 [+] UCSC Ensembl
Mir-431 chr12: 109590459-109590523 [+] UCSC Ensembl
Mir-433 chr12: 109591729-109591802 [+] UCSC Ensembl
Mir-127 chr12: 109592854-109592909 [+] UCSC Ensembl
Mir-136-v1 chr12: 109595331-109595386 [+] UCSC Ensembl
Mir-136-v2 chr12: 109595331-109595386 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCACGUCGUUGUCCUGCGCGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUAACGUUGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCUUCAUCCCCAACGACG
Get precursor sequence
Structure
        10           20        30        40        50        60 
GCACGUCGUUGUCCUGCG---|   C       U          C  UCA    GGCCACACU 
                     CGUC UGCGAGG GUCUUGCAGG CG   UGCA         G
                     GCAG ACGCUCU CGGGACGUUC GC   ACGU         A
GCAGCAACCCCUACUUCUACA^   A       U          U  UGG    UGCAAUGGC 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites +2 and +3 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-431_5p

MirBase accessionMIMAT0001418
Sequence
0- UGUCUUGCAGGCCGUCAUGCA -21
Get sequence
Validated targets microrna.org: MIMAT0001418
TargetScanVert: mmu-miR-431-5p
miRDB: MIMAT0001418
Star sequence

Mmu-Mir-431_3p*

MirBase accessionMIMAT0004753
Sequence
43- CAGGUCGUCUUGCAGGGCUUCU -65
Get sequence
Validated targets microrna.org: MIMAT0004753
TargetScanVert: mmu-miR-431-3p
miRDB: MIMAT0004753