MirGeneDB

MirGeneDB ID

Dre-Mir-1388

Family name MIR-1388 (all species)
Seed UCUCAGG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-1388
Paralogues
Orthologues Aca-Mir-1388  Ami-Mir-1388  Bta-Mir-1388  Cfa-Mir-1388  Cli-Mir-1388  Cpi-Mir-1388  Cpo-Mir-1388  Dno-Mir-1388  Ete-Mir-1388  Gga-Mir-1388  Mdo-Mir-1388  Oan-Mir-1388  Sha-Mir-1388  Sto-Mir-1388  Tgu-Mir-1388 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(danRer11)
chr23: 13604240-13604298 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUAAUCUGAUGGAUGAGCAGUGCUUUCCAGGACUGUCCAACCUGAGAAUGCUUGAGUUUUGGUCAAUCUCAGGUUCGUCAGCCCAUGAAAAACUGUCUCGCUCAAAGCCACAUGGAC
Get precursor sequence
Structure
        10           20        30        40        50         
ACAUAAUCUGAUGGAUGA---|    GC    CA  A   UCC         A  CUUGAG 
                     GCAGU  UUUC  GG CUG   AACCUGAGA UG      \
                     UGUCA  AAAG  CC GAC   UUGGACUCU AC      U
CAGGUACACCGAAACUCGCUC^    A-    UA  C   UGC         A  UGGUUU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-1388_5p*

MirBase accessionMIMAT0011292
Sequence
0- AGGACUGUCCAACCUGAGAAUG -22
Get sequence
Mature sequence

Dre-Mir-1388_3p

MirBase accessionMIMAT0011293
Sequence
37- AUCUCAGGUUCGUCAGCCCAUG -59
Get sequence
Validated targets TargetScanFish: dre-miR-1388