MirGeneDB

MirGeneDB ID

Cli-Mir-1388

Family name MIR-1388 (all species)
Seed GGACUGU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-1388
Paralogues
Orthologues Aca-Mir-1388  Ami-Mir-1388  Bta-Mir-1388  Cfa-Mir-1388  Cpi-Mir-1388  Cpo-Mir-1388  Dno-Mir-1388  Dre-Mir-1388  Ete-Mir-1388  Gga-Mir-1388  Mdo-Mir-1388  Oan-Mir-1388  Sha-Mir-1388  Sto-Mir-1388  Tgu-Mir-1388 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(colLiv2)
scaffold36: 1588268-1588329 [-]
Precursor
(pre-Mir +30nt flank)
UCGGCGGCUGCCCAAGCGAGAGGCACCUCGAGGACUGUCUAACCUGAGAAUGGUGAAAUGUAAGGGUCAAUCUCAGGUUCGUCAGCCCAUGAGACGCCUUCUCCAGAGCAGGACAGGCAGCG
Get precursor sequence
Structure
        10          20         30        40        50          
UCGGCGGCUGCCCAAGC--   -|   AC    A  A   UCU         A  GUGAAAU 
                   GAG AGGC  CUCG GG CUG   AACCUGAGA UG       \
                   CUC UCCG  GAGU CC GAC   UUGGACUCU AC       G
GCGACGGACAGGACGAGAC   U^   CA    A  C   UGC         A  UGGGAAU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Mir-1388_5p

MirBase accessionMIMAT0038674
Sequence
0- AGGACUGUCUAACCUGAGAAUG -22
Get sequence
Star sequence

Cli-Mir-1388_3p*

MirBase accessionMIMAT0038675
Sequence
39- AUCUCAGGUUCGUCAGCCCAUGA -62
Get sequence