MirGeneDB

MirGeneDB ID

Aca-Mir-1388

Family name MIR-1388 (all species)
Seed GGACUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1388
Paralogues
Orthologues Ami-Mir-1388  Bta-Mir-1388  Cfa-Mir-1388  Cli-Mir-1388  Cpi-Mir-1388  Cpo-Mir-1388  Dno-Mir-1388  Dre-Mir-1388  Ete-Mir-1388  Gga-Mir-1388  Mdo-Mir-1388  Oan-Mir-1388  Sha-Mir-1388  Sto-Mir-1388  Tgu-Mir-1388 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
4: 156036018-156036078 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAGGGAUUGCCCAGGUGAGGAGUUUUUUGAGGACUGUCUAACCUGAGAAUGGUGAAUCAUGAAGGUCAAUCUCAGGUCCGUCAGCCCACGAGAAGCUGCCUCCAGAGCUCUGGGGCCACA
Get precursor sequence
Structure
        10         20         30        40        50          
CCAGGGAUUGCCCAGGU-    -|        A  A   UCUA        A  GUGAAUC 
                  GAGG AGUUUUUUG GG CUG    ACCUGAGA UG       \
                  CUCC UCGAAGAGC CC GAC    UGGACUCU AC       A
ACACCGGGGUCUCGAGAC    G^        A  C   UGCC        A  UGGAAGU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1388_5p

MirBase accessionMIMAT0021760
Sequence
0- AGGACUGUCUAACCUGAGAAUG -22
Get sequence
Star sequence

Aca-Mir-1388_3p*

MirBase accessionMIMAT0021761
Sequence
39- AUCUCAGGUCCGUCAGCCCACG -61
Get sequence