MirGeneDB

MirGeneDB ID

Sto-Mir-1388

Family name MIR-1388 (all species)
Seed GGACUGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-1388  Ami-Mir-1388  Bta-Mir-1388  Cfa-Mir-1388  Cli-Mir-1388  Cpi-Mir-1388  Cpo-Mir-1388  Dno-Mir-1388  Dre-Mir-1388  Ete-Mir-1388  Gga-Mir-1388  Mdo-Mir-1388  Oan-Mir-1388  Sha-Mir-1388  Tgu-Mir-1388 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(miRNA_loci_genome)
BFAA01000670.1: 364959-365018 [-]
Precursor
(pre-Mir +30nt flank)
AGCUGAAAGACAAUGUUGAGAGGUGCCUCAAGGACUGUCUAACCUGAGAAUGGUGAAAAUGAAGGUCAAUCUCAGGUCCGUCAGCCCAUGAAACACGUCUCGUUUGCUAAGAAAAACCCC
Get precursor sequence
Structure
        10          20        30        40        50         
AGCUGAAAGACAAUGUU--|   G   CC   A  A   UCUA        A   UGAAA 
                   GAGA GUG  UCA GG CUG    ACCUGAGA UGG     A
                   CUCU CAC  AGU CC GAC    UGGACUCU ACU     U
CCCCAAAAAGAAUCGUUUG^   G   AA   A  C   UGCC        A   GGAAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Sto-Mir-1388_5p

MirBase accessionNone
Sequence
0- AGGACUGUCUAACCUGAGAAUGG -23
Get sequence
Star sequence

Sto-Mir-1388_3p*

MirBase accessionNone
Sequence
37- AAUCUCAGGUCCGUCAGCCCAUG -60
Get sequence