MirGeneDB

MirGeneDB ID

Cli-Mir-458-as

Family name MIR-458 (all species)
Seed UAGCUCU
Species Rock pigeon (Columba livia)
MiRBase ID
Paralogues Cli-Mir-458 
Orthologues Aca-Mir-458  Ami-Mir-458  Cpi-Mir-458  Dre-Mir-458  Gga-Mir-458  Gga-Mir-458-as  Oan-Mir-458  Tgu-Mir-458  Xtr-Mir-458 
Node of Origin (locus) Neognathae
Node of Origin (family) Osteichthyes
Genome context
(colLiv2)
scaffold636: 126030-126087 [-]
Precursor
(pre-Mir +30nt flank)
CUUAGAUGCUGGUUUUCCGGUACAUAUGGCAGUACCAUUCAAAGAGCUAUGACAAUGAGACUGUUUAUAGCUCUGGAAAUGGCGCUGCCAUCUGCACCACGGUGCAGCGGCUCAUCCC
Get precursor sequence
Structure
        10          20        30        40        50        
CUUAGAUGCUGGUUUUCC--|  A  U       UA     CAA          CAAUG 
                    GGU CA AUGGCAG  CCAUU   AGAGCUAUGA     A
                    CCA GU UACCGUC  GGUAA   UCUCGAUAUU     G
CCCUACUCGGCGACGUGGCA^  C  C       GC     AGG          UGUCA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-458-as_5p*

MirBase accessionNone
Sequence
0- AGUACCAUUCAAAGAGCUAUGA -22
Get sequence
Mature sequence

Cli-Mir-458-as_3p

MirBase accessionNone
Sequence
36- AUAGCUCUGGAAAUGGCGCUGC -58
Get sequence