MirGeneDB

MirGeneDB ID

Cli-Mir-458

Family name MIR-458 (all species)
Seed UAGCUCU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-458
Paralogues Cli-Mir-458-as 
Orthologues Aca-Mir-458  Ami-Mir-458  Cpi-Mir-458  Dre-Mir-458  Gga-Mir-458  Gga-Mir-458-as  Oan-Mir-458  Tgu-Mir-458  Xtr-Mir-458 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(colLiv2)
scaffold636: 126032-126089 [+]
Precursor
(pre-Mir +30nt flank)
GAUGAGCCGCUGCACCGUGGUGCAGAUGGCAGCGCCAUUUCCAGAGCUAUAAACAGUCUCAUUGUCAUAGCUCUUUGAAUGGUACUGCCAUAUGUACCGGAAAACCAGCAUCUAAGCU
Get precursor sequence
Structure
        10          20        30        40        50        
GAUGAGCCGCUGCACCG--|      G       CG      CC        AAACAGU 
                   UGGUGCA AUGGCAG  CCAUUU  AGAGCUAU       C
                   GCCAUGU UACCGUC  GGUAAG  UCUCGAUA       U
UCGAAUCUACGACCAAAAG^      A       AU      UU        CUGUUAC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-458_5p*

MirBase accessionMIMAT0038649
Sequence
0- AGCGCCAUUUCCAGAGCUAUAA -22
Get sequence
Mature sequence

Cli-Mir-458_3p

MirBase accessionMIMAT0038650
Sequence
36- AUAGCUCUUUGAAUGGUACUGC -58
Get sequence