MirGeneDB

MirGeneDB ID

Cli-Mir-202

Family name MIR-202 (all species)
Seed UCCUAUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-202
Paralogues
Orthologues Aca-Mir-202  Ami-Mir-202  Bta-Mir-202  Cfa-Mir-202  Cpi-Mir-202  Cpo-Mir-202  Dno-Mir-202  Dre-Mir-202  Ete-Mir-202  Gga-Mir-202  Hsa-Mir-202  Mml-Mir-202  Mmu-Mir-202  Oan-Mir-202  Ocu-Mir-202  Rno-Mir-202  Sha-Mir-202  Sto-Mir-202  Tgu-Mir-202-P3  Tgu-Mir-202-P4  Xtr-Mir-202-P1  Xtr-Mir-202-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold262: 1438281-1438338 [+]
Precursor
(pre-Mir +30nt flank)
GUGGAUCUUGAUCUGACUCGUUGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGAAUUUGAUCUAAAGAGGCAUAGGGCAUGGGAAAAUGGGGCGACUGAGGUACUUCACCAUUUAUU
Get precursor sequence
Structure
        10          20        30        40         50        
GUGGAUCUUGAUCUGACUC--        U           A-|  A       GAGAAU 
                     GUUGUUCC UUUUCCUAUGC  UAU CUUCUUU      \
                     CAGCGGGG AAAAGGGUACG  AUA GGAGAAA      U
UUAUUUACCACUUCAUGGAGU        U           GG^  C       UCUAGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-202_5p

MirBase accessionMIMAT0038579
Sequence
0- UUCCUAUGCAUAUACUUCUUU -21
Get sequence
Star sequence

Cli-Mir-202_3p* (predicted)

MirBase accessionNone
Sequence
36- AGAGGCAUAGGGCAUGGGAAAA -58
Get sequence