MirGeneDB

MirGeneDB ID

Aca-Mir-202

Family name MIR-202 (all species)
Seed UCCUAUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-202
Paralogues
Orthologues Ami-Mir-202  Bta-Mir-202  Cfa-Mir-202  Cli-Mir-202  Cpi-Mir-202  Cpo-Mir-202  Dno-Mir-202  Dre-Mir-202  Ete-Mir-202  Gga-Mir-202  Hsa-Mir-202  Mml-Mir-202  Mmu-Mir-202  Oan-Mir-202  Ocu-Mir-202  Rno-Mir-202  Sha-Mir-202  Sto-Mir-202  Tgu-Mir-202-P3  Tgu-Mir-202-P4  Xtr-Mir-202-P1  Xtr-Mir-202-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343262.1: 426464-426521 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUCAUCAAUUUCUGCUCAUUGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGAAUCUGAUCUAAAGAGGCAUACGGCAUGGGAAAAUGGGGCAAUUGAGGUAUUCCUCCACCAUCC
Get precursor sequence
Structure
        10          20        30        40         50        
UUUUCAUCAAUUUCUGC-  -        U           A-|  A       GAGAAU 
                  UC AUUGUUCC UUUUCCUAUGC  UAU CUUCUUU      \
                  AG UAACGGGG AAAAGGGUACG  AUA GGAGAAA      C
CCUACCACCUCCUUAUGG  U        U           GC^  C       UCUAGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-202_5p

MirBase accessionMIMAT0021848
Sequence
0- UUCCUAUGCAUAUACUUCUUU -21
Get sequence
Star sequence

Aca-Mir-202_3p*

MirBase accessionMIMAT0021849
Sequence
36- AGAGGCAUACGGCAUGGGAAAA -58
Get sequence