MirGeneDB

MirGeneDB ID

Rno-Mir-383-v1

Family name MIR-383 (all species)
Seed GAUCAGA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-383
Paralogues Rno-Mir-383-v2 
Orthologues Aca-Mir-383-v1  Ami-Mir-383-v1  Bta-Mir-383-v1  Cfa-Mir-383-v1  Cli-Mir-383-v1  Cpi-Mir-383-v1  Cpo-Mir-383-v1  Dno-Mir-383-v1  Ete-Mir-383-v1  Gga-Mir-383-v1  Hsa-Mir-383-v1  Mdo-Mir-383-v1  Mml-Mir-383-v1  Mmu-Mir-383-v1  Oan-Mir-383-v1  Ocu-Mir-383-v1  Sha-Mir-383-v1  Tgu-Mir-383-v1  Xtr-Mir-383-v1 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Tetrapoda
Genome context
(rn6)
chr16: 57519680-57519741 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-383-v1)
Mir-383-v2 chr16: 57519679-57519741 [+] UCSC Ensembl
Mir-383-v1 chr16: 57519680-57519741 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCAGAAACUCCACGUCACCUGCUCCUCAGAUCAGAAGGUGACUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAGCAAGUGUCCUAGCCUUUUACCUCAU
Get precursor sequence
Structure
        10         20         30        40        50        60 
CCUCCAGAAACUCCACGU-   C     C-| A      AA    A        UUGGGUGG 
                   CAC UGCUC  UC GAUCAG  GGUG CUGUGGCU        \
                   GUG ACGAG  AG CUGGUC  UCAC GACACCGA        A
UACUCCAUUUUCCGAUCCU   A     AA^ A      CG    -        CUAAUUAU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-383-v1_5p

MirBase accessionMIMAT0003114
Sequence
0- AGAUCAGAAGGUGACUGUGGCU -22
Get sequence
Validated targets microrna.org: MIMAT0003114
TargetScanVert: rno-miR-383-5p
miRDB: MIMAT0003114
Star sequence

Rno-Mir-383-v1_3p*

MirBase accessionMIMAT0017197
Sequence
41- CCACAGCACUGCCUGGUCAGA -62
Get sequence
Validated targets TargetScanVert: rno-miR-383-3p
miRDB: MIMAT0017197