MirGeneDB

MirGeneDB ID

Aca-Mir-383-v1

Family name MIR-383 (all species)
Seed GAUCAGA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-383
Paralogues Aca-Mir-383-v2 
Orthologues Ami-Mir-383-v1  Bta-Mir-383-v1  Cfa-Mir-383-v1  Cli-Mir-383-v1  Cpi-Mir-383-v1  Cpo-Mir-383-v1  Dno-Mir-383-v1  Ete-Mir-383-v1  Gga-Mir-383-v1  Hsa-Mir-383-v1  Mdo-Mir-383-v1  Mml-Mir-383-v1  Mmu-Mir-383-v1  Oan-Mir-383-v1  Ocu-Mir-383-v1  Rno-Mir-383-v1  Sha-Mir-383-v1  Tgu-Mir-383-v1  Xtr-Mir-383-v1 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Tetrapoda
Genome context
(anoCar2)
5: 106709396-106709457 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-383-v1)
Mir-383-v1 5: 106709396-106709457 [-] UCSC Ensembl
Mir-383-v2 5: 106709396-106709458 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGGGAGACCCCUCAAGUCACCUGCUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGCUUUUAUAUGAAACAGCCACAGCACUGCCUGGUCAGAAAGAGCAAGUGUACUAGCCUUUUGCCUCAU
Get precursor sequence
Structure
        10         20         30        40        50        60 
CUGGGAGACCCCUCAAGU-   C     C-| A      AA    A        UUGCUUUU 
                   CAC UGCUC  UC GAUCAG  GGUG UUGUGGCU        \
                   GUG ACGAG  AG CUGGUC  UCAC GACACCGA        A
UACUCCGUUUUCCGAUCAU   A     AA^ A      CG    -        CAAAGUAU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-383-v1_5p

MirBase accessionMIMAT0021952
Sequence
0- AGAUCAGAAGGUGAUUGUGGCU -22
Get sequence
Star sequence

Aca-Mir-383-v1_3p*

MirBase accessionMIMAT0021953
Sequence
41- CCACAGCACUGCCUGGUCAGA -62
Get sequence