MirGeneDB

MirGeneDB ID

Rno-Mir-218-P2

Family name MIR-218 (all species)
Seed UGUGCUU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-218a-2
Paralogues Rno-Mir-218-P1 
Orthologues Aca-Mir-218-P2  Ami-Mir-218-P2  Bta-Mir-218-P2  Cfa-Mir-218-P2  Cli-Mir-218-P2  Cpi-Mir-218-P2  Cpo-Mir-218-P2  Dno-Mir-218-P2  Dre-Mir-218-P2-v1  Dre-Mir-218-P2-v2  Ete-Mir-218-P2  Gga-Mir-218-P2  Hsa-Mir-218-P2  Mdo-Mir-218-P2  Mml-Mir-218-P2  Mmu-Mir-218-P2  Oan-Mir-218-P2  Ocu-Mir-218-P2  Sha-Mir-218-P2  Sto-Mir-218-P2  Tgu-Mir-218-P2  Xtr-Mir-218-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr10: 20428685-20428748 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACUCUGACCAGUUGCCGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCAUCGCUCUCUCCUGCAGCAUGGCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GACUCUGACCAGUUGCC--|  GG       UUU         CU        GGUGGAACG 
                   GCG  GCUUUCC   GUGCUUGAU  AACCAUGU         A
                   CGC  CGAAAGG   CACGAACUG  UUGGUACA         U
CCGGUACGACGUCCUCUCU^  UA       CGC         UC        AGGCAAAGG 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut +1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-218-P2_5p

MirBase accessionMIMAT0000888
Sequence
0- UUGUGCUUGAUCUAACCAUGU -21
Get sequence
Validated targets microrna.org: MIMAT0000888
TargetScanVert: rno-miR-218a-5p
miRDB: MIMAT0000888
Star sequence

Rno-Mir-218-P2_3p*

MirBase accessionMIMAT0004740
Sequence
43- AUGGUUCUGUCAAGCACCGCG -64
Get sequence
Validated targets microrna.org: MIMAT0004740
TargetScanVert: rno-miR-218a-2-3p
miRDB: MIMAT0004740