MirGeneDB

MirGeneDB ID

Aca-Mir-218-P2

Family name MIR-218 (all species)
Seed UGUGCUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-218-2
Paralogues Aca-Mir-218-P1 
Orthologues Ami-Mir-218-P2  Bta-Mir-218-P2  Cfa-Mir-218-P2  Cli-Mir-218-P2  Cpi-Mir-218-P2  Cpo-Mir-218-P2  Dno-Mir-218-P2  Dre-Mir-218-P2-v1  Dre-Mir-218-P2-v2  Ete-Mir-218-P2  Gga-Mir-218-P2  Hsa-Mir-218-P2  Mdo-Mir-218-P2  Mml-Mir-218-P2  Mmu-Mir-218-P2  Oan-Mir-218-P2  Ocu-Mir-218-P2  Rno-Mir-218-P2  Sha-Mir-218-P2  Sto-Mir-218-P2  Tgu-Mir-218-P2  Xtr-Mir-218-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 112860800-112860863 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUGACUCUUCCUGUUAAUGGGAUUUUCCUUUGUGCUUGAUCUAACCAUGUGGUAGAACAAUACAAAUUGAACAUGGUUCUGUCAAGCACCAUGGAAGGCUCCAUGCUUUCCUGCAGCAUGGCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACUGACUCUUCCUGUUA--|   GA      UUU         CU        GGUAGAACA 
                   AUGG  UUUUCC   GUGCUUGAU  AACCAUGU         A
                   UACC  GGAAGG   CACGAACUG  UUGGUACA         U
ACGGUACGACGUCCUUUCG^   UC      UAC         UC        AGUUAAACA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-218-P2_5p

MirBase accessionMIMAT0021880
Sequence
0- UUGUGCUUGAUCUAACCAUGU -21
Get sequence
Star sequence

Aca-Mir-218-P2_3p* (predicted)

MirBase accessionNone
Sequence
43- AUGGUUCUGUCAAGCACCAUG -64
Get sequence