MirGeneDB

MirGeneDB ID

Rno-Mir-154-P29-v1

Family name MIR-154 (all species)
Seed AGGUCAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-1193
Paralogues Rno-Mir-154-P1  Rno-Mir-154-P2-v1  Rno-Mir-154-P2-v2  Rno-Mir-154-P3a-v1  Rno-Mir-154-P3a-v2  Rno-Mir-154-P4  Rno-Mir-154-P5  Rno-Mir-154-P6  Rno-Mir-154-P7  Rno-Mir-154-P8  Rno-Mir-154-P9  Rno-Mir-154-P10  Rno-Mir-154-P12  Rno-Mir-154-P13  Rno-Mir-154-P14  Rno-Mir-154-P15  Rno-Mir-154-P17  Rno-Mir-154-P18  Rno-Mir-154-P19  Rno-Mir-154-P20-v1  Rno-Mir-154-P20-v2  Rno-Mir-154-P21  Rno-Mir-154-P22  Rno-Mir-154-P26  Rno-Mir-154-P29-v2  Rno-Mir-154-P30  Rno-Mir-154-P34  Rno-Mir-154-P36 
Orthologues Bta-Mir-154-P29  Cfa-Mir-154-P29  Cpo-Mir-154-P29  Dno-Mir-154-P29  Ete-Mir-154-P29  Hsa-Mir-154-P29  Mml-Mir-154-P29  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133864729-133864785 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P29-v1)
Mir-154-P7 chr6: 133857715-133857772 [+] UCSC Ensembl
Mir-154-P13 chr6: 133858859-133858914 [+] UCSC Ensembl
Mir-154-P2-v1 chr6: 133859329-133859383 [+] UCSC Ensembl
Mir-154-P2-v2 chr6: 133859330-133859382 [+] UCSC Ensembl
Mir-154-P8 chr6: 133860500-133860556 [+] UCSC Ensembl
Mir-154-P3a-v2 chr6: 133861214-133861269 [+] UCSC Ensembl
Mir-154-P3a-v1 chr6: 133861214-133861269 [+] UCSC Ensembl
Mir-154-P26 chr6: 133861509-133861566 [+] UCSC Ensembl
Mir-154-P4 chr6: 133862190-133862249 [+] UCSC Ensembl
Mir-154-P18 chr6: 133864385-133864440 [+] UCSC Ensembl
Mir-154-P29-v1 chr6: 133864729-133864785 [+] UCSC Ensembl
Mir-154-P29-v2 chr6: 133864730-133864784 [+] UCSC Ensembl
Mir-666 chr6: 133866541-133866601 [+] UCSC Ensembl
Mir-154-P22 chr6: 133866672-133866729 [+] UCSC Ensembl
Mir-154-P19 chr6: 133868298-133868357 [+] UCSC Ensembl
Mir-667 chr6: 133869584-133869647 [+] UCSC Ensembl
Mir-376-P4 chr6: 133872453-133872510 [+] UCSC Ensembl
Mir-376-P3 chr6: 133873110-133873167 [+] UCSC Ensembl
Mir-376-P1 chr6: 133873618-133873675 [+] UCSC Ensembl
Mir-154-P34 chr6: 133874161-133874223 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCUUACUGCUCUCAGGGUAGCUGUGAGGAUGGUAAACCGGUGACGUGCACUUCAUUUAUGCUGUAGGUCACCCGUUUUACUAUCCGCCAGCACCCAGACCGUCUGUGGGAUGAUA
Get precursor sequence
Structure
        10            20        30         40        50       
GUGCUUACUGCUCUCAG----|  A    UGA          - C      G    CUUCA 
                     GGU GCUG   GGAUGGUAAA C GGUGAC UGCA     U
                     CCA CGAC   CCUAUCAUUU G CCACUG AUGU     U
AUAGUAGGGUGUCUGCCAGAC^  -    CG-          U C      G    CGUAU 
     110       100         90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-154-P29-v1_5p* (predicted)

MirBase accessionMIMAT0017858
Sequence
0- AUGGUAAACCGGUGACGUGCA -21
Get sequence
Validated targets TargetScanVert: rno-miR-1193-5p
miRDB: MIMAT0017858
Mature sequence

Rno-Mir-154-P29-v1_3p

MirBase accessionMIMAT0017859
Sequence
35- UAGGUCACCCGUUUUACUAUCC -57
Get sequence
Validated targets TargetScanVert: rno-miR-1193-3p
miRDB: MIMAT0017859