MirGeneDB

MirGeneDB ID

Rno-Mir-154-P2-v1

Family name MIR-154 (all species)
Seed AUGUGGG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-299a
Paralogues Rno-Mir-154-P1  Rno-Mir-154-P2-v2  Rno-Mir-154-P3a-v1  Rno-Mir-154-P3a-v2  Rno-Mir-154-P4  Rno-Mir-154-P5  Rno-Mir-154-P6  Rno-Mir-154-P7  Rno-Mir-154-P8  Rno-Mir-154-P9  Rno-Mir-154-P10  Rno-Mir-154-P12  Rno-Mir-154-P13  Rno-Mir-154-P14  Rno-Mir-154-P15  Rno-Mir-154-P17  Rno-Mir-154-P18  Rno-Mir-154-P19  Rno-Mir-154-P20-v1  Rno-Mir-154-P20-v2  Rno-Mir-154-P21  Rno-Mir-154-P22  Rno-Mir-154-P26  Rno-Mir-154-P29-v1  Rno-Mir-154-P29-v2  Rno-Mir-154-P30  Rno-Mir-154-P34  Rno-Mir-154-P36 
Orthologues Bta-Mir-154-P2-v1  Bta-Mir-154-P2-v2  Cfa-Mir-154-P2-v1  Cfa-Mir-154-P2-v2  Cpo-Mir-154-P2-v1  Cpo-Mir-154-P2-v2  Dno-Mir-154-P2-v1  Dno-Mir-154-P2-v2  Ete-Mir-154-P2-v1  Ete-Mir-154-P2-v2  Hsa-Mir-154-P2-v1  Hsa-Mir-154-P2-v2  Mml-Mir-154-P2-v1  Mml-Mir-154-P2-v2  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Ocu-Mir-154-P2-v1  Ocu-Mir-154-P2-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133859329-133859383 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P2-v1)
Mir-154-P7 chr6: 133857715-133857772 [+] UCSC Ensembl
Mir-154-P13 chr6: 133858859-133858914 [+] UCSC Ensembl
Mir-154-P2-v1 chr6: 133859329-133859383 [+] UCSC Ensembl
Mir-154-P2-v2 chr6: 133859330-133859382 [+] UCSC Ensembl
Mir-154-P8 chr6: 133860500-133860556 [+] UCSC Ensembl
Mir-154-P3a-v2 chr6: 133861214-133861269 [+] UCSC Ensembl
Mir-154-P3a-v1 chr6: 133861214-133861269 [+] UCSC Ensembl
Mir-154-P26 chr6: 133861509-133861566 [+] UCSC Ensembl
Mir-154-P4 chr6: 133862190-133862249 [+] UCSC Ensembl
Mir-154-P18 chr6: 133864385-133864440 [+] UCSC Ensembl
Mir-154-P29-v1 chr6: 133864729-133864785 [+] UCSC Ensembl
Mir-154-P29-v2 chr6: 133864730-133864784 [+] UCSC Ensembl
Mir-666 chr6: 133866541-133866601 [+] UCSC Ensembl
Mir-154-P22 chr6: 133866672-133866729 [+] UCSC Ensembl
Mir-154-P19 chr6: 133868298-133868357 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUCCCUGCUGUCACGCGGUACUUGAAGAAAUGGUUUACCGUCCCACAUACAUUUUGAGUAUGUAUGUGGGACGGUAAACCGCUUCUUGGUAUCCAGCCCAGCCAUCCAGUCCGU
Get precursor sequence
Structure
        10            20        30        40        50       
UGUCCCUGCUGUCACGC----|     UG     A                     UUUU 
                     GGUACU  AAGAA UGGUUUACCGUCCCACAUACA    \
                     CUAUGG  UUCUU GCCAAAUGGCAGGGUGUAUGU    G
UGCCUGACCUACCGACCCGAC^     --     C                     AUGA 
   110       100        90          80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-154-P2-v1_5p*

MirBase accessionMIMAT0000901
Sequence
0- AUGGUUUACCGUCCCACAUACA -22
Get sequence
Validated targets microrna.org: MIMAT0000901
TargetScanVert: rno-miR-299a-5p
miRDB: MIMAT0000901
Mature sequence

Rno-Mir-154-P2-v1_3p

MirBase accessionMIMAT0017167
Sequence
33- UAUGUGGGACGGUAAACCGCUU -55
Get sequence
Validated targets TargetScanVert: rno-miR-299a-3p
miRDB: MIMAT0017167