MirGeneDB

MirGeneDB ID

Bta-Mir-154-P2-v1

Family name MIR-154 (all species)
Seed AUGUGGG
Species Cow (Bos taurus)
MiRBase ID bta-mir-299
Paralogues Bta-Mir-154-P1  Bta-Mir-154-P2-v2  Bta-Mir-154-P3a-v1  Bta-Mir-154-P3a-v2  Bta-Mir-154-P3b  Bta-Mir-154-P4a  Bta-Mir-154-P4b  Bta-Mir-154-P5  Bta-Mir-154-P6  Bta-Mir-154-P7  Bta-Mir-154-P8  Bta-Mir-154-P9  Bta-Mir-154-P10  Bta-Mir-154-P12  Bta-Mir-154-P13  Bta-Mir-154-P14  Bta-Mir-154-P15  Bta-Mir-154-P16  Bta-Mir-154-P17  Bta-Mir-154-P18  Bta-Mir-154-P19  Bta-Mir-154-P20  Bta-Mir-154-P21  Bta-Mir-154-P22  Bta-Mir-154-P23  Bta-Mir-154-P24  Bta-Mir-154-P25  Bta-Mir-154-P26  Bta-Mir-154-P28  Bta-Mir-154-P29  Bta-Mir-154-P30  Bta-Mir-154-P31  Bta-Mir-154-P32  Bta-Mir-154-P33  Bta-Mir-154-P36  Bta-Mir-154-P37 
Orthologues Cfa-Mir-154-P2-v1  Cfa-Mir-154-P2-v2  Cpo-Mir-154-P2-v1  Cpo-Mir-154-P2-v2  Dno-Mir-154-P2-v1  Dno-Mir-154-P2-v2  Ete-Mir-154-P2-v1  Ete-Mir-154-P2-v2  Hsa-Mir-154-P2-v1  Hsa-Mir-154-P2-v2  Mml-Mir-154-P2-v1  Mml-Mir-154-P2-v2  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Ocu-Mir-154-P2-v1  Ocu-Mir-154-P2-v2  Rno-Mir-154-P2-v1  Rno-Mir-154-P2-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67563575-67563629 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P2-v1)
Mir-154-P7 chr21: 67561884-67561942 [+] UCSC Ensembl
Mir-154-P13 chr21: 67563113-67563168 [+] UCSC Ensembl
Mir-154-P2-v1 chr21: 67563575-67563629 [+] UCSC Ensembl
Mir-154-P2-v2 chr21: 67563576-67563628 [+] UCSC Ensembl
Mir-154-P8 chr21: 67564806-67564862 [+] UCSC Ensembl
Mir-154-P37 chr21: 67564967-67565022 [+] UCSC Ensembl
Mir-154-P30 chr21: 67565319-67565374 [+] UCSC Ensembl
Mir-154-P3a-v2 chr21: 67565483-67565538 [+] UCSC Ensembl
Mir-154-P3a-v1 chr21: 67565483-67565538 [+] UCSC Ensembl
Mir-154-P26 chr21: 67565781-67565838 [+] UCSC Ensembl
Mir-154-P4a chr21: 67566520-67566577 [+] UCSC Ensembl
Mir-154-P4b chr21: 67566830-67566889 [+] UCSC Ensembl
Mir-154-P18 chr21: 67569692-67569747 [+] UCSC Ensembl
Mir-154-P29 chr21: 67570037-67570092 [+] UCSC Ensembl
Mir-154-P22 chr21: 67571836-67571894 [+] UCSC Ensembl
Mir-154-P19 chr21: 67573248-67573304 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGUCACUGCCAUCGUGCGGUACUUGAAGAAAUGGUUUACCGUCCCACAUACAUUCUGAAUAUGUAUGUGGGACGGUAAACCGCUUCUUGGUAUCCAGCCCAGCCAUCAAAAGCCU
Get precursor sequence
Structure
        10            20        30        40        50       
CGUCACUGCCAUCGUGC----|     UG     A                     UUCU 
                     GGUACU  AAGAA UGGUUUACCGUCCCACAUACA    \
                     CUAUGG  UUCUU GCCAAAUGGCAGGGUGUAUGU    G
UCCGAAAACUACCGACCCGAC^     --     C                     AUAA 
   110       100        90          80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-154-P2-v1_5p*

MirBase accessionMIMAT0009274
Sequence
0- AUGGUUUACCGUCCCACAUACA -22
Get sequence
Validated targets TargetScanVert: bta-miR-299
Mature sequence

Bta-Mir-154-P2-v1_3p

MirBase accessionNone
Sequence
33- UAUGUGGGACGGUAAACCGCUU -55
Get sequence