MirGeneDB

MirGeneDB ID

Bta-Mir-154-P36

Family name MIR-154 (all species)
Seed GGUUACC
Species Cow (Bos taurus)
MiRBase ID bta-mir-409a
Paralogues Bta-Mir-154-P1  Bta-Mir-154-P2-v1  Bta-Mir-154-P2-v2  Bta-Mir-154-P3a-v1  Bta-Mir-154-P3a-v2  Bta-Mir-154-P3b  Bta-Mir-154-P4a  Bta-Mir-154-P4b  Bta-Mir-154-P5  Bta-Mir-154-P6  Bta-Mir-154-P7  Bta-Mir-154-P8  Bta-Mir-154-P9  Bta-Mir-154-P10  Bta-Mir-154-P12  Bta-Mir-154-P13  Bta-Mir-154-P14  Bta-Mir-154-P15  Bta-Mir-154-P16  Bta-Mir-154-P17  Bta-Mir-154-P18  Bta-Mir-154-P19  Bta-Mir-154-P20  Bta-Mir-154-P21  Bta-Mir-154-P22  Bta-Mir-154-P23  Bta-Mir-154-P24  Bta-Mir-154-P25  Bta-Mir-154-P26  Bta-Mir-154-P28  Bta-Mir-154-P29  Bta-Mir-154-P30  Bta-Mir-154-P31  Bta-Mir-154-P32  Bta-Mir-154-P33  Bta-Mir-154-P37 
Orthologues Cfa-Mir-154-P36  Cpo-Mir-154-P36  Dno-Mir-154-P36  Ete-Mir-154-P36  Hsa-Mir-154-P36  Mmu-Mir-154-P36  Ocu-Mir-154-P36  Rno-Mir-154-P36 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67603260-67603313 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P36)
Mir-134 chr21: 67593262-67593324 [+] UCSC Ensembl
Mir-154-P15 chr21: 67593963-67594021 [+] UCSC Ensembl
Mir-154-P1 chr21: 67598053-67598110 [+] UCSC Ensembl
Mir-154-P32 chr21: 67598367-67598427 [+] UCSC Ensembl
Mir-154-P20 chr21: 67598891-67598944 [+] UCSC Ensembl
Mir-154-P6 chr21: 67600496-67600555 [+] UCSC Ensembl
Mir-541 chr21: 67602353-67602418 [+] UCSC Ensembl
Mir-3957 chr21: 67602740-67602798 [+] UCSC Ensembl
Mir-154-P36 chr21: 67603260-67603313 [+] UCSC Ensembl
Mir-154-P14 chr21: 67603405-67603460 [+] UCSC Ensembl
Mir-154-P5 chr21: 67603548-67603603 [+] UCSC Ensembl
Mir-154-P12 chr21: 67603879-67603934 [+] UCSC Ensembl
Mir-154-P25 chr21: 67604696-67604752 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGUCCGAGCCUCUCCAUGGUACGCGGGGAGAGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUCAAAAUCCAUCAGAGAGGCCA
Get precursor sequence
Structure
        10           20        30        40         50      
CGUCCGAGCCUCUCCAU---|    G  GG   A    AC         -    CAUCU 
                    GGUAC CG  GAG GGUU  CCGAGCAAC UUUG     \
                    CUAUG GC  UUC CCAA  GGCUCGUUG AAGC     G
ACCGGAGAGACUACCUAAAA^    -  UU   C    GU         U    AGCAG 
  110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentThis gene was classified as a non-canonical miRNA in Fromm et al. (2015) given that the Dicer cut is consistently +4 but the Drosha cut is +2 and reads are abrogated with the Drosha knock-out and hence it is accepted here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-154-P36_5p

MirBase accessionMIMAT0009310
Sequence
0- AGGUUACCCGAGCAACUUUGCAU -23
Get sequence
Validated targets TargetScanVert: bta-miR-409a
Star sequence

Bta-Mir-154-P36_3p*

MirBase accessionNone
Sequence
32- GAAUGUUGCUCGGUGAACCCCU -54
Get sequence