MirGeneDB

MirGeneDB ID

Bta-Mir-154-P10

Family name MIR-154 (all species)
Seed AAGUUGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-382
Paralogues Bta-Mir-154-P1  Bta-Mir-154-P2-v1  Bta-Mir-154-P2-v2  Bta-Mir-154-P3a-v1  Bta-Mir-154-P3a-v2  Bta-Mir-154-P3b  Bta-Mir-154-P4a  Bta-Mir-154-P4b  Bta-Mir-154-P5  Bta-Mir-154-P6  Bta-Mir-154-P7  Bta-Mir-154-P8  Bta-Mir-154-P9  Bta-Mir-154-P12  Bta-Mir-154-P13  Bta-Mir-154-P14  Bta-Mir-154-P15  Bta-Mir-154-P16  Bta-Mir-154-P17  Bta-Mir-154-P18  Bta-Mir-154-P19  Bta-Mir-154-P20  Bta-Mir-154-P21  Bta-Mir-154-P22  Bta-Mir-154-P23  Bta-Mir-154-P24  Bta-Mir-154-P25  Bta-Mir-154-P26  Bta-Mir-154-P28  Bta-Mir-154-P29  Bta-Mir-154-P30  Bta-Mir-154-P31  Bta-Mir-154-P32  Bta-Mir-154-P33  Bta-Mir-154-P36  Bta-Mir-154-P37 
Orthologues Cfa-Mir-154-P10  Cpo-Mir-154-P10  Dno-Mir-154-P10  Ete-Mir-154-P10  Hsa-Mir-154-P10  Mml-Mir-154-P10  Mmu-Mir-154-P10  Ocu-Mir-154-P10  Rno-Mir-154-P10 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67592888-67592945 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P10)
Mir-154-P9 chr21: 67583080-67583142 [+] UCSC Ensembl
Mir-154-P17 chr21: 67583572-67583629 [+] UCSC Ensembl
Mir-154-P21 chr21: 67584380-67584444 [+] UCSC Ensembl
Mir-544 chr21: 67586376-67586433 [+] UCSC Ensembl
Mir-154-P24 chr21: 67587337-67587396 [+] UCSC Ensembl
Mir-154-P31 chr21: 67589488-67589541 [+] UCSC Ensembl
Mir-154-P16 chr21: 67589876-67589933 [+] UCSC Ensembl
Mir-154-P10 chr21: 67592888-67592945 [+] UCSC Ensembl
Mir-134 chr21: 67593262-67593324 [+] UCSC Ensembl
Mir-154-P15 chr21: 67593963-67594021 [+] UCSC Ensembl
Mir-154-P1 chr21: 67598053-67598110 [+] UCSC Ensembl
Mir-154-P32 chr21: 67598367-67598427 [+] UCSC Ensembl
Mir-154-P20 chr21: 67598891-67598944 [+] UCSC Ensembl
Mir-154-P6 chr21: 67600496-67600555 [+] UCSC Ensembl
Mir-541 chr21: 67602353-67602418 [+] UCSC Ensembl
Mir-3957 chr21: 67602740-67602798 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCCUCUGCCUUUCUGUGGUACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUAUGACGAAUCAUUCACGGACAACACUUUUUUCAGUACCAAAUACUACCUCUAAGGAUG
Get precursor sequence
Structure
        10          20        30         40        50        
UUGCCUCUGCCUUUCUG--|      U       A-           UG      CUUUA 
                   UGGUACU GAAGAGA  GUUGUUCGUGG  GAUUCG     C
                   ACCAUGA CUUUUUU  CAACAGGCACU  CUAAGC     U
GUAGGAAUCUCCAUCAUAA^      -       CA           UA      AGUAU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-154-P10_5p

MirBase accessionMIMAT0009308
Sequence
0- GAAGUUGUUCGUGGUGGAUUCG -22
Get sequence
Validated targets TargetScanVert: bta-miR-382
Co-mature sequence

Bta-Mir-154-P10_3p

MirBase accessionNone
Sequence
36- AAUCAUUCACGGACAACACUUU -58
Get sequence