MirGeneDB

MirGeneDB ID

Bta-Mir-154-P31

Family name MIR-154 (all species)
Seed GUUGAUC
Species Cow (Bos taurus)
MiRBase ID bta-mir-411c
Paralogues Bta-Mir-154-P1  Bta-Mir-154-P2-v1  Bta-Mir-154-P2-v2  Bta-Mir-154-P3a-v1  Bta-Mir-154-P3a-v2  Bta-Mir-154-P3b  Bta-Mir-154-P4a  Bta-Mir-154-P4b  Bta-Mir-154-P5  Bta-Mir-154-P6  Bta-Mir-154-P7  Bta-Mir-154-P8  Bta-Mir-154-P9  Bta-Mir-154-P10  Bta-Mir-154-P12  Bta-Mir-154-P13  Bta-Mir-154-P14  Bta-Mir-154-P15  Bta-Mir-154-P16  Bta-Mir-154-P17  Bta-Mir-154-P18  Bta-Mir-154-P19  Bta-Mir-154-P20  Bta-Mir-154-P21  Bta-Mir-154-P22  Bta-Mir-154-P23  Bta-Mir-154-P24  Bta-Mir-154-P25  Bta-Mir-154-P26  Bta-Mir-154-P28  Bta-Mir-154-P29  Bta-Mir-154-P30  Bta-Mir-154-P32  Bta-Mir-154-P33  Bta-Mir-154-P36  Bta-Mir-154-P37 
Orthologues Cfa-Mir-154-P31  Cpo-Mir-154-P31  Dno-Mir-154-P31  Ete-Mir-154-P31  Mml-Mir-154-P31 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67589488-67589541 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P31)
Mir-376-P1 chr21: 67579444-67579501 [+] UCSC Ensembl
Mir-154-P28 chr21: 67581384-67581443 [+] UCSC Ensembl
Mir-3956-v1 chr21: 67582114-67582198 [+] UCSC Ensembl
Mir-3956-v2 chr21: 67582115-67582197 [+] UCSC Ensembl
Mir-154-P9 chr21: 67583080-67583142 [+] UCSC Ensembl
Mir-154-P17 chr21: 67583572-67583629 [+] UCSC Ensembl
Mir-154-P21 chr21: 67584380-67584444 [+] UCSC Ensembl
Mir-544 chr21: 67586376-67586433 [+] UCSC Ensembl
Mir-154-P24 chr21: 67587337-67587396 [+] UCSC Ensembl
Mir-154-P31 chr21: 67589488-67589541 [+] UCSC Ensembl
Mir-154-P16 chr21: 67589876-67589933 [+] UCSC Ensembl
Mir-154-P10 chr21: 67592888-67592945 [+] UCSC Ensembl
Mir-134 chr21: 67593262-67593324 [+] UCSC Ensembl
Mir-154-P15 chr21: 67593963-67594021 [+] UCSC Ensembl
Mir-154-P1 chr21: 67598053-67598110 [+] UCSC Ensembl
Mir-154-P32 chr21: 67598367-67598427 [+] UCSC Ensembl
Mir-154-P20 chr21: 67598891-67598944 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGGCGUGGUCCGUGAUAGGGGAGUGGAUGGUUGAUCAGAGAACAUACAUUUUGUCAAUGAUGUAUGUCAACUGAUCCACAGUCCCUCCCUAUCCAGUCACUUCUCAGGACAG
Get precursor sequence
Structure
        10           20        30        40        50      
CAGGGCGUGGUCCGUGAUA---|     U    G  U      AGA         UUG 
                      GGGGAG GGAU GU GAUCAG   ACAUACAUU   U
                      UCCCUC CCUG CA CUAGUC   UGUAUGUAG   C
GACAGGACUCUUCACUGACCUA^     -    A  C      AAC         UAA 
  110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-154-P31_5p

MirBase accessionMIMAT0025545
Sequence
0- GGUUGAUCAGAGAACAUACAUU -22
Get sequence
Validated targets TargetScanVert: bta-miR-411c-5p
Star sequence

Bta-Mir-154-P31_3p*

MirBase accessionMIMAT0025546
Sequence
32- UGUAUGUCAACUGAUCCACAGU -54
Get sequence
Validated targets TargetScanVert: bta-miR-411c-3p