MirGeneDB

MirGeneDB ID

Rno-Mir-154-P9

Family name MIR-154 (all species)
Seed AUACAAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-381
Paralogues Rno-Mir-154-P1  Rno-Mir-154-P2-v1  Rno-Mir-154-P2-v2  Rno-Mir-154-P3a-v1  Rno-Mir-154-P3a-v2  Rno-Mir-154-P4  Rno-Mir-154-P5  Rno-Mir-154-P6  Rno-Mir-154-P7  Rno-Mir-154-P8  Rno-Mir-154-P10  Rno-Mir-154-P12  Rno-Mir-154-P13  Rno-Mir-154-P14  Rno-Mir-154-P15  Rno-Mir-154-P17  Rno-Mir-154-P18  Rno-Mir-154-P19  Rno-Mir-154-P20-v1  Rno-Mir-154-P20-v2  Rno-Mir-154-P21  Rno-Mir-154-P22  Rno-Mir-154-P26  Rno-Mir-154-P29-v1  Rno-Mir-154-P29-v2  Rno-Mir-154-P30  Rno-Mir-154-P34  Rno-Mir-154-P36 
Orthologues Bta-Mir-154-P9  Cfa-Mir-154-P9  Cpo-Mir-154-P9  Dno-Mir-154-P9  Ete-Mir-154-P9  Hsa-Mir-154-P9  Mml-Mir-154-P9  Mmu-Mir-154-P9  Ocu-Mir-154-P9 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133876615-133876677 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P9)
Mir-154-P22 chr6: 133866672-133866729 [+] UCSC Ensembl
Mir-154-P19 chr6: 133868298-133868357 [+] UCSC Ensembl
Mir-667 chr6: 133869584-133869647 [+] UCSC Ensembl
Mir-376-P4 chr6: 133872453-133872510 [+] UCSC Ensembl
Mir-376-P3 chr6: 133873110-133873167 [+] UCSC Ensembl
Mir-376-P1 chr6: 133873618-133873675 [+] UCSC Ensembl
Mir-154-P34 chr6: 133874161-133874223 [+] UCSC Ensembl
Mir-154-P9 chr6: 133876615-133876677 [+] UCSC Ensembl
Mir-154-P17 chr6: 133877137-133877194 [+] UCSC Ensembl
Mir-154-P21 chr6: 133877840-133877901 [+] UCSC Ensembl
Mir-544 chr6: 133879179-133879235 [+] UCSC Ensembl
Mir-154-P10 chr6: 133884190-133884247 [+] UCSC Ensembl
Mir-134 chr6: 133884554-133884614 [+] UCSC Ensembl
Mir-154-P15 chr6: 133885310-133885368 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUGCCCCAUGCUAUUGUUUGGUACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGGAUAUACAAGGGCAAGCUCUCUGUGAGCAUCAAACCUUAUCUUGGAUCCUGUCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACCUGCCCCAUGCUAUU--|      A    A  C   G        U       CGGUUUA 
                   GUUUGGU CUUA AG GAG UUGCCCUU GUAUAUU       U
                   CAAACUA GAGU UC CUC AACGGGAA CAUAUAG       U
CCUGUCCUAGGUUCUAUUC^      C    G  U   G        -       GGUACAG 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-154-P9_5p*

MirBase accessionMIMAT0017220
Sequence
0- AGCGAGGUUGCCCUUUGUAUAUU -23
Get sequence
Validated targets TargetScanVert: rno-miR-381-5p
miRDB: MIMAT0017220
Mature sequence

Rno-Mir-154-P9_3p

MirBase accessionMIMAT0003199
Sequence
41- UAUACAAGGGCAAGCUCUCUGU -63
Get sequence
Validated targets microrna.org: MIMAT0003199
TargetScanVert: rno-miR-381-3p
miRDB: MIMAT0003199