MirGeneDB

MirGeneDB ID

Rno-Mir-154-P14

Family name MIR-154 (all species)
Seed GGUCGAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-412
Paralogues Rno-Mir-154-P1  Rno-Mir-154-P2-v1  Rno-Mir-154-P2-v2  Rno-Mir-154-P3a-v1  Rno-Mir-154-P3a-v2  Rno-Mir-154-P4  Rno-Mir-154-P5  Rno-Mir-154-P6  Rno-Mir-154-P7  Rno-Mir-154-P8  Rno-Mir-154-P9  Rno-Mir-154-P10  Rno-Mir-154-P12  Rno-Mir-154-P13  Rno-Mir-154-P15  Rno-Mir-154-P17  Rno-Mir-154-P18  Rno-Mir-154-P19  Rno-Mir-154-P20-v1  Rno-Mir-154-P20-v2  Rno-Mir-154-P21  Rno-Mir-154-P22  Rno-Mir-154-P26  Rno-Mir-154-P29-v1  Rno-Mir-154-P29-v2  Rno-Mir-154-P30  Rno-Mir-154-P34  Rno-Mir-154-P36 
Orthologues Bta-Mir-154-P14  Cpo-Mir-154-P14  Dno-Mir-154-P14  Ete-Mir-154-P14  Hsa-Mir-154-P14  Mml-Mir-154-P14  Mmu-Mir-154-P14 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr6: 133893579-133893634 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P14)
Mir-154-P10 chr6: 133884190-133884247 [+] UCSC Ensembl
Mir-134 chr6: 133884554-133884614 [+] UCSC Ensembl
Mir-154-P15 chr6: 133885310-133885368 [+] UCSC Ensembl
Mir-154-P1 chr6: 133888600-133888657 [+] UCSC Ensembl
Mir-154-P20-v2 chr6: 133889296-133889351 [+] UCSC Ensembl
Mir-154-P20-v1 chr6: 133889297-133889350 [+] UCSC Ensembl
Mir-154-P6 chr6: 133890697-133890756 [+] UCSC Ensembl
Mir-541 chr6: 133892668-133892733 [+] UCSC Ensembl
Mir-154-P36 chr6: 133893432-133893485 [+] UCSC Ensembl
Mir-154-P14 chr6: 133893579-133893634 [+] UCSC Ensembl
Mir-154-P5 chr6: 133893706-133893761 [+] UCSC Ensembl
Mir-154-P12 chr6: 133894007-133894062 [+] UCSC Ensembl
Mir-3072 chr6: 133898823-133898879 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUCAUCUUCGCUCUGGGGUAUGGGACGGAUGGUCGACCAGCUGGAAAGUAAUUGUUUCUAAUGUACUUCACCUGGUCCACUAGCCGUCGGUGCCCGCCGCAGCCUGCGCCAGGAU
Get precursor sequence
Structure
        10            20        30        40        50        
ACUCAUCUUCGCUCUGG----|    G G    A    C      C   AA    AUUGUU 
                     GGUAU G ACGG UGGU GACCAG UGG  AGUA      \
                     CCGUG C UGCC AUCA CUGGUC ACU  UCAU      U
UAGGACCGCGUCCGACGCCGC^    G -    G    C      C   --    GUAAUC 
    110       100        90         80        70          60
Deep sequencing
Go to detailed chart
CommentThere is variation in the Drosha cut with a high number of reads shifted -1 relative to the phylogenetically conserved cut annotated here.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-154-P14_5p

MirBase accessionMIMAT0017204
Sequence
0- UGGUCGACCAGCUGGAAAGUAAU -23
Get sequence
Validated targets TargetScanVert: rno-miR-412-5p
miRDB: MIMAT0017204
Star sequence

Rno-Mir-154-P14_3p*

MirBase accessionMIMAT0003124
Sequence
34- UACUUCACCUGGUCCACUAGCC -56
Get sequence
Validated targets microrna.org: MIMAT0003124
TargetScanVert: rno-miR-412-3p
miRDB: MIMAT0003124