| MirGeneDB ID | Pbv-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-130a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-130-P1a Pbv-Mir-130-P1b Pbv-Mir-130-P2a Pbv-Mir-130-P2b Pbv-Mir-130-P3a Pbv-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P1c Ami-Mir-130-P1c Bta-Mir-130-P1c Cfa-Mir-130-P1c Cja-Mir-130-P1c Cpi-Mir-130-P1c Cpo-Mir-130-P1c Dno-Mir-130-P1c Eca-Mir-130-P1c Ete-Mir-130-P1c Gja-Mir-130-P1c Hsa-Mir-130-P1c Laf-Mir-130-P1c Lch-Mir-130-P1c Mdo-Mir-130-P1c Mml-Mir-130-P1c Mmr-Mir-130-P1c Mmu-Mir-130-P1c Mun-Mir-130-P1c Neu-Mir-130-P1c Oan-Mir-130-P1c Ocu-Mir-130-P1c Pab-Mir-130-P1c Rno-Mir-130-P1c Sha-Mir-130-P1c Spt-Mir-130-P1c Sto-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE953228.1: 125041-125098 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGGAUGCACUGGGCACGGCCCCUGCCCGAGGCUCUUUUCACAUUGUGCUACUGAGCCCAACCCAAGCAGUGCAAUGUAAAAAGGGCAUUGGGUUGGUGGCCACAGCAGCAAGAAUUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CGGAUGCACUGGGCACG- -| U G C UG A GAGCC GCC CC GCCCGA GCUCUUUU ACAUUG CU CU C CGG GG UGGGUU CGGGAAAA UGUAAC GA GA A UCUUAAGAACGACGACAC U^ U A A GU C ACCCA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | The monouridylation of the 3p arm is supported by the existence of multiple examples of 3' DcRNA reads that start with the U in human and several other vertebrates. All other taxa are treated accordingly. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-130-P1c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038926 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUCUUUUCACAUUGUGCUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-130-P1c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038927 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- CAGUGCAAUGUAAAAAGGGCAU -58
Get sequence
|
