| MirGeneDB ID | Esc-Mir-2-o47d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Hawaiian bobtail squid (Euprymna scolopes) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Esc-Mir-2-o45-v1 Esc-Mir-2-o47a-v1 Esc-Mir-2-o47b Esc-Mir-2-o47c Esc-Mir-2-o48-v1 Esc-Mir-2-o49 Esc-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Npo-Mir-2-o47 Obi-Mir-2-o47d Ovu-Mir-2-o47d Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Coleoidea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (esc-GCA_024364805.1_ASM2436480v1) |
CM044488.1: 27563803-27563860 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o47d) |
Mir-2-o49
CM044488.1: 27562752-27562815 [-]
Ensembl
Mir-2-o48-v1 CM044488.1: 27562855-27562918 [-] Ensembl Mir-2-o48-v2 CM044488.1: 27562855-27562918 [-] Ensembl Mir-2-o47d CM044488.1: 27563803-27563860 [-] Ensembl Mir-2-o47c CM044488.1: 27564000-27564059 [-] Ensembl Mir-2-o47b CM044488.1: 27564469-27564528 [-] Ensembl Mir-2-o47a-v1 CM044488.1: 27564797-27564854 [-] Ensembl Mir-2-o47a-v2 CM044488.1: 27564797-27564854 [-] Ensembl Mir-2-P12 CM044488.1: 27565399-27565460 [-] Ensembl Mir-2-o45-v1 CM044488.1: 27565591-27565650 [-] Ensembl Mir-2-o45-v2 CM044488.1: 27565591-27565650 [-] Ensembl Mir-71 CM044488.1: 27565864-27565922 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAUGAAAGGUAUCAUCUGACCACCUCGCAACUCAUCAACUGGUUGUGAUGUGCUAUCUUUGACAUAUCACAGCUAGCUUUGAUGAGCUGUGACUUGGGCAUCAUCAACAUGCUGGAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AAUGAAAGGUAUCAUCUGA-- CC A --| CUAU CCA UCGCA CUCAUCAA CUGGUUGUGAUGUG C GGU AGUGU GAGUAGUU GAUCGACACUAUAC U UAAGGUCGUACAACUACUACG UC C UC^ AGUU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Esc-Mir-2-o47d_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUCAUCAACUGGUUGUGAUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Esc-Mir-2-o47d_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- UAUCACAGCUAGCUUUGAUGAGCU -58
Get sequence
|
