MirGeneDB

MirGeneDB ID

Aca-Mir-451

Family name MIR-451 (all species)
Seed AACCGUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-451
Paralogues
Orthologues Ami-Mir-451  Bta-Mir-451  Cfa-Mir-451  Cli-Mir-451  Cpi-Mir-451  Cpo-Mir-451  Dno-Mir-451  Dre-Mir-451  Ete-Mir-451  Gga-Mir-451  Hsa-Mir-451  Mdo-Mir-451  Mml-Mir-451  Mmu-Mir-451  Oan-Mir-451  Ocu-Mir-451  Rno-Mir-451  Sha-Mir-451  Sto-Mir-451  Tgu-Mir-451  Xtr-Mir-451 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
G889P68288RO14: 156-197 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-451)
Mir-451 G889P68288RO14: 156-197 [-] UCSC Ensembl
Mir-144 G889P68288RO14: 343-398 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGAAGAAGAACUGACCGGUGUGUUGGCGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUUCUAUCACGCCGACUUCCGCCGAAGCAAGAA
Get precursor sequence
Structure
        10          20        30        40        50
GAAGAAGAAGAACUGAC--|      U   CGA    G           GA 
                   CGGUGUG UGG   AACC UUACCAUUACU  G
                   GCCGCAC AUC   UUGG AAUGGUAAUGA  U
AAGAACGAAGCCGCCUUCA^      U   UUC    G           UU 
100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentAs a Group 4 miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary.
3' NTU NA
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-451_5p

MirBase accessionMIMAT0021960
Sequence
0- AAACCGUUACCAUUACUGAGUUU -23
Get sequence