MirGeneDB

MirGeneDB ID

Aae-Mir-279-P1

Family name MIR-279 (all species)
Seed GACUAGA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-279
Paralogues Aae-Mir-279-o26  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Aae-Mir-279-P3 
Orthologues Cgi-Mir-279  Dan-Mir-279-P1  Dme-Mir-279-P1  Dmo-Mir-279-P1  Dpu-Mir-279-o1  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.437: 572258-572322 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P1)
Mir-279-P3 supercont1.437: 567506-567574 [-] Ensembl
Mir-279-P1 supercont1.437: 572258-572322 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCCGAGUACCAAACAUCCCAACGGUUGUCGAUGGGUGUGAAUCUAGUGUUUCACAUGAUUUUCGAUAGCCUGUGACUAGAUCCACACUCAUUAACAAAAGUUGCCGGAAAGCAUCCACUUCCAU
Get precursor sequence
Structure
        10          20        30        40        50        60  
CGCCGAGUACCAAACAUCC--|   GG    CG         A       GUUUCACAUGAUU 
                     CAAC  UUGU  AUGGGUGUG AUCUAGU             \
                     GUUG  AACA  UACUCACAC UAGAUCA             U
UACCUUCACCUACGAAAGGCC^   AA    AU         C       GUGUCCGAUAGCU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-279-P1_5p*

MirBase accessionNone
Sequence
0- GAUGGGUGUGAAUCUAGUGUUU -22
Get sequence
Mature sequence

Aae-Mir-279-P1_3p

MirBase accessionMIMAT0014288
Sequence
43- UGACUAGAUCCACACUCAUUAA -65
Get sequence