MirGeneDB

MirGeneDB ID

Aae-Mir-279-o26

Family name MIR-279 (all species)
Seed GACUAGA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-2945
Paralogues Aae-Mir-279-P1  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Aae-Mir-279-P3 
Orthologues Asu-Mir-279-o26  Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) Diptera
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.43: 958696-958759 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGUUUCGUUUUAUUAUGAUUUUCUGAUCUGAGCGGGUCCGUUUCUAGUGUCAUGUGCUGUAUUCGAAUAUCAUGACUAGAGGCAGACUCGUUUAGGUCUGGGAUCGUUGUCUUCAGUUUGCUUA
Get precursor sequence
Structure
        10          20        30        40        50        60  
AGUUUCGUUUUAUUAUGAU--|UU U              C       GU      UGCUGUA 
                     U  C GAUCUGAGCGGGUC GUUUCUA  GUCAUG       U
                     A  G CUGGAUUUGCUCAG CGGAGAU  CAGUAC       U
AUUCGUUUGACUUCUGUUGCU^GG U              A       --      UAUAAGC 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-279-o26_5p*

MirBase accessionMIMAT0014315
Sequence
0- AGCGGGUCCGUUUCUAGUGUCAUG -24
Get sequence
Mature sequence

Aae-Mir-279-o26_3p

MirBase accessionMIMAT0014316
Sequence
42- UGACUAGAGGCAGACUCGUUUA -64
Get sequence