MirGeneDB

MirGeneDB ID

Cgi-Mir-279

Family name MIR-279 (all species)
Seed GACUAGA
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues
Orthologues Aae-Mir-279-o26  Aae-Mir-279-P1  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Aae-Mir-279-P3  Asu-Mir-279-o26  Asu-Mir-279-o27  Asu-Mir-279-o28  Asu-Mir-279-o29  Asu-Mir-279-o30  Bge-Mir-279-o35  Bge-Mir-279-o36  Bge-Mir-279-o37  Bge-Mir-279-o38  Bge-Mir-279-o39  Cbr-Mir-279-o7  Cbr-Mir-279-o8a  Cbr-Mir-279-o8b  Cbr-Mir-279-o9  Cbr-Mir-279-o10  Cel-Mir-279-o7  Cel-Mir-279-o8  Cel-Mir-279-o9  Cel-Mir-279-o10  Cte-Mir-279-o11  Cte-Mir-279-o12  Cte-Mir-279-o13  Dan-Mir-279-P1  Dan-Mir-279-P2  Dan-Mir-279-P3  Dme-Mir-279-P1  Dme-Mir-279-P2  Dme-Mir-279-P3  Dmo-Mir-279-P1  Dmo-Mir-279-P2  Dmo-Mir-279-P3  Dpu-Mir-279-o1  Dpu-Mir-279-o2  Dpu-Mir-279-o3  Dpu-Mir-279-o4  Dpu-Mir-279-o5  Dpu-Mir-279-o6  Efe-Mir-279-o14  Efe-Mir-279-o15  Efe-Mir-279-o16  Efe-Mir-279-o17  Efe-Mir-279-o18  Efe-Mir-279-o19  Efe-Mir-279-o20  Hme-Mir-279-o31  Hme-Mir-279-o32  Hme-Mir-279-o33  Hme-Mir-279-o34  Isc-Mir-279  Lan-Mir-279-o40  Lan-Mir-279-o41  Lgi-Mir-279  Tca-Mir-279-o21  Tca-Mir-279-o22  Tca-Mir-279-o23  Tca-Mir-279-o24  Tca-Mir-279-o25 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(CGI_GCA_000297895.1)
scaffold43988: 13126-13181 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUUUUAUUUCUUAUGCCCUUUCCUCGGAUGGGUGUGUGUCUAUUCCAUGUUGAAAAUGGCCAUGACUAGAUCCACACUCAUCCAAGAGGAGGGAAAUCACUGCAAAGUUUGCA
Get precursor sequence
Structure
        10          20        30        40        50        
AAAAUUUUAUUUCUUAUG--|    UC  C           UG    UUC    UUGAA 
                    CCCUU  CU GGAUGGGUGUG  UCUA   CAUG     \
                    GGGAG  GA CCUACUCACAC  AGAU   GUAC     A
ACGUUUGAAACGUCACUAAA^    GA  A           CU    CA-    CGGUA 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-279_5p*

MirBase accessionNone
Sequence
0- AUGGGUGUGUGUCUAUUCCAUG -22
Get sequence
Mature sequence

Cgi-Mir-279_3p

MirBase accessionNone
Sequence
35- UGACUAGAUCCACACUCAUCC -56
Get sequence