MirGeneDB

MirGeneDB ID

Aae-Mir-279-P2a

Family name MIR-279 (all species)
Seed GACUAGA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-286a
Paralogues Aae-Mir-279-o26  Aae-Mir-279-P1  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Aae-Mir-279-P3 
Orthologues Cgi-Mir-279  Dan-Mir-279-P2  Dme-Mir-279-P2  Dmo-Mir-279-P2  Dpu-Mir-279-o2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. aegypti
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.464: 825007-825079 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P2a)
Mir-279-P2a supercont1.464: 825007-825079 [+] Ensembl
Mir-3-P2b supercont1.464: 825634-825696 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGGACUAAACACUUGGGAAUCGUUAUUUGGGGCGAUUGUCGGACUAGUCGCUGCGUACAAAACGGAACUAUUUCAACUAGUGACUAGACCGAACACUCGCGUCCUAAAGCACGAUCAGUUCAACGUUGGAGCG
Get precursor sequence
Structure
        10        20        30           40        50        60     
CGGACUAAACACUUGGGA     UA         AU--  -|   A         GCGUACAAAACG 
                  AUCGU  UUUGGGGCG    UG UCGG CUAGUCGCU            G
                  UAGCA  AAAUCCUGC    AC AGCC GAUCAGUGA            A
GCGAGGUUGCAACUUGAC     CG         GCUC  A^   A         UCAACUUUAUCA 
 130       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-279-P2a_5p* (predicted)

MirBase accessionNone
Sequence
0- GGCGAUUGUCGGACUAGUCGCU -22
Get sequence
Mature sequence

Aae-Mir-279-P2a_3p

MirBase accessionMIMAT0014314
Sequence
50- UGACUAGACCGAACACUCGCGUC -73
Get sequence