MirGeneDB

MirGeneDB ID

Sto-Mir-101-P2-v2

Family name MIR-101 (all species)
Seed ACAGUAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-101-P1-v1  Sto-Mir-101-P1-v2  Sto-Mir-101-P2-v1 
Orthologues Aca-Mir-101-P2-v1  Aca-Mir-101-P2-v2  Ami-Mir-101-P2-v1  Ami-Mir-101-P2-v2  Bta-Mir-101-P2-v1  Bta-Mir-101-P2-v2  Cfa-Mir-101-P2-v1  Cfa-Mir-101-P2-v2  Cli-Mir-101-P2-v1  Cli-Mir-101-P2-v2  Cpi-Mir-101-P2-v1  Cpi-Mir-101-P2-v2  Cpo-Mir-101-P2-v1  Cpo-Mir-101-P2-v2  Dno-Mir-101-P2-v1  Dno-Mir-101-P2-v2  Dre-Mir-101-P2-v1  Dre-Mir-101-P2-v2  Ete-Mir-101-P2-v1  Ete-Mir-101-P2-v2  Gga-Mir-101-P2-v1  Gga-Mir-101-P2-v2  Hsa-Mir-101-P2-v1  Hsa-Mir-101-P2-v2  Mdo-Mir-101-P2-v1  Mdo-Mir-101-P2-v2  Mml-Mir-101-P2-v1  Mml-Mir-101-P2-v2  Mmu-Mir-101-P2-v1  Mmu-Mir-101-P2-v2  Oan-Mir-101-P2-v1  Oan-Mir-101-P2-v2  Ocu-Mir-101-P2-v1  Ocu-Mir-101-P2-v2  Rno-Mir-101-P2-v1  Rno-Mir-101-P2-v2  Sha-Mir-101-P2-v1  Sha-Mir-101-P2-v2  Tgu-Mir-101-P2-v1  Tgu-Mir-101-P2-v2  Xtr-Mir-101-P2-v1  Xtr-Mir-101-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(miRNA_loci_genome)
BFAA01004869.1: 93866-93924 [+]
Precursor
(pre-Mir +30nt flank)
CUGAAGGCCCAAGAUCUGAACUGUCCUUUUUCAGUUAUCACGGUACCGGUGCUGUUUCUUCAAGAGGUACAGUACUGUGAUAACUGAAGAGUGGCAGUGCCAUCACAAGACUGUUGAAC
Get precursor sequence
Structure
        10          20        30        40        50         
CUGAAGGCCCAAGAUCUGA--|     C                    CG    UGUUUC 
                     ACUGUC UUUUUCAGUUAUCACGGUAC  GUGC      U
                     UGACGG GAGAAGUCAAUAGUGUCAUG  CAUG      U
CAAGUUGUCAGAACACUACCG^     U                    A-    GAGAAC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-101-P2-v2_5p*

MirBase accessionNone
Sequence
0- UCAGUUAUCACGGUACCGGUGC -22
Get sequence
Mature sequence

Sto-Mir-101-P2-v2_3p

MirBase accessionNone
Sequence
37- UACAGUACUGUGAUAACUGAAG -59
Get sequence