MirGeneDB

MirGeneDB ID

Mmu-Mir-101-P2-v1

Family name MIR-101 (all species)
Seed UACAGUA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-101b
Paralogues Mmu-Mir-101-P1-v1  Mmu-Mir-101-P1-v2  Mmu-Mir-101-P2-v2 
Orthologues Aca-Mir-101-P2-v1  Aca-Mir-101-P2-v2  Ami-Mir-101-P2-v1  Ami-Mir-101-P2-v2  Bta-Mir-101-P2-v1  Bta-Mir-101-P2-v2  Cfa-Mir-101-P2-v1  Cfa-Mir-101-P2-v2  Cli-Mir-101-P2-v1  Cli-Mir-101-P2-v2  Cpi-Mir-101-P2-v1  Cpi-Mir-101-P2-v2  Cpo-Mir-101-P2-v1  Cpo-Mir-101-P2-v2  Dno-Mir-101-P2-v1  Dno-Mir-101-P2-v2  Dre-Mir-101-P2-v1  Dre-Mir-101-P2-v2  Ete-Mir-101-P2-v1  Ete-Mir-101-P2-v2  Gga-Mir-101-P2-v1  Gga-Mir-101-P2-v2  Hsa-Mir-101-P2-v1  Hsa-Mir-101-P2-v2  Mdo-Mir-101-P2-v1  Mdo-Mir-101-P2-v2  Mml-Mir-101-P2-v1  Mml-Mir-101-P2-v2  Oan-Mir-101-P2-v1  Oan-Mir-101-P2-v2  Ocu-Mir-101-P2-v1  Ocu-Mir-101-P2-v2  Rno-Mir-101-P2-v1  Rno-Mir-101-P2-v2  Sha-Mir-101-P2-v1  Sha-Mir-101-P2-v2  Sto-Mir-101-P2-v1  Sto-Mir-101-P2-v2  Tgu-Mir-101-P2-v1  Tgu-Mir-101-P2-v2  Xtr-Mir-101-P2-v1  Xtr-Mir-101-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mm10)
chr19: 29135303-29135359 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-101-P2-v1)
Mir-101-P2-v2 chr19: 29135302-29135360 [+] UCSC Ensembl
Mir-101-P2-v1 chr19: 29135303-29135359 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUAGAUCUGAGACUGAACUGCCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAGCUCUGAAAGGUACAGUACUGUGAUAGCUGAAGAAUGGCGGUGCCAUCACGUUGAGGGGAGG
Get precursor sequence
Structure
        10          20        30        40        50        
AGGUAGAUCUGAGACUGA--|     C                    CGA    GUAGC 
                    ACUGCC UUUUUCGGUUAUCAUGGUAC   UGCU     U
                    UGGCGG AAGAAGUCGAUAGUGUCAUG   AUGG     C
GGAGGGGAGUUGCACUACCG^     U                    AC-    AAAGU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-101-P2-v1_5p*

MirBase accessionMIMAT0017046
Sequence
0- CGGUUAUCAUGGUACCGAUGCUG -23
Get sequence
Validated targets TargetScanVert: mmu-miR-101b-5p
miRDB: MIMAT0017046
Mature sequence

Mmu-Mir-101-P2-v1_3p

MirBase accessionMIMAT0000616
Sequence
35- GUACAGUACUGUGAUAGCUGAA -57
Get sequence
Validated targets microrna.org: MIMAT0000616
TargetScanVert: mmu-miR-101b-3p.1
miRDB: MIMAT0000616