MirGeneDB

MirGeneDB ID

Aca-Mir-101-P2-v1

Family name MIR-101 (all species)
Seed UACAGUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-101-2
Paralogues Aca-Mir-101-P1-v1  Aca-Mir-101-P1-v2  Aca-Mir-101-P2-v2 
Orthologues Ami-Mir-101-P2-v1  Ami-Mir-101-P2-v2  Bta-Mir-101-P2-v1  Bta-Mir-101-P2-v2  Cfa-Mir-101-P2-v1  Cfa-Mir-101-P2-v2  Cli-Mir-101-P2-v1  Cli-Mir-101-P2-v2  Cpi-Mir-101-P2-v1  Cpi-Mir-101-P2-v2  Cpo-Mir-101-P2-v1  Cpo-Mir-101-P2-v2  Dno-Mir-101-P2-v1  Dno-Mir-101-P2-v2  Dre-Mir-101-P2-v1  Dre-Mir-101-P2-v2  Ete-Mir-101-P2-v1  Ete-Mir-101-P2-v2  Gga-Mir-101-P2-v1  Gga-Mir-101-P2-v2  Hsa-Mir-101-P2-v1  Hsa-Mir-101-P2-v2  Mdo-Mir-101-P2-v1  Mdo-Mir-101-P2-v2  Mml-Mir-101-P2-v1  Mml-Mir-101-P2-v2  Mmu-Mir-101-P2-v1  Mmu-Mir-101-P2-v2  Oan-Mir-101-P2-v1  Oan-Mir-101-P2-v2  Ocu-Mir-101-P2-v1  Ocu-Mir-101-P2-v2  Rno-Mir-101-P2-v1  Rno-Mir-101-P2-v2  Sha-Mir-101-P2-v1  Sha-Mir-101-P2-v2  Sto-Mir-101-P2-v1  Sto-Mir-101-P2-v2  Tgu-Mir-101-P2-v1  Tgu-Mir-101-P2-v2  Xtr-Mir-101-P2-v1  Xtr-Mir-101-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
2: 52137658-52137714 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-101-P2-v1)
Mir-101-P2-v2 2: 52137657-52137715 [+] UCSC Ensembl
Mir-101-P2-v1 2: 52137658-52137714 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAACAACUAGACUGUGAACUGUCCUUUUUCGGUUAUCAUGGUACCGGUGCUGUAUAUCUGAAAGGUACAGUACUGUGAUAACUGAAGAAUGAUGGUGCCAUCACAAUGAGAUGGGA
Get precursor sequence
Structure
        10          20        30        40        50        
AAAACAACUAGACUGUGA--|     C                    CG     GUAUA 
                    ACUGUC UUUUUCGGUUAUCAUGGUAC  GUGCU     U
                    UGGUAG AAGAAGUCAAUAGUGUCAUG  CAUGG     C
AGGGUAGAGUAACACUACCG^     U                    A-     AAAGU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-101-P2-v1_5p*

MirBase accessionMIMAT0021712
Sequence
0- CGGUUAUCAUGGUACCGGUGCUG -23
Get sequence
Mature sequence

Aca-Mir-101-P2-v1_3p

MirBase accessionMIMAT0021711
Sequence
35- GUACAGUACUGUGAUAACUGAA -57
Get sequence