
MirGeneDB ID


Family name MIR-101 (all species)
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-101-P1-v1  Sto-Mir-101-P1-v2  Sto-Mir-101-P2-v2 
Orthologues Aca-Mir-101-P2-v1  Aca-Mir-101-P2-v2  Ami-Mir-101-P2-v1  Ami-Mir-101-P2-v2  Bta-Mir-101-P2-v1  Bta-Mir-101-P2-v2  Cfa-Mir-101-P2-v1  Cfa-Mir-101-P2-v2  Cli-Mir-101-P2-v1  Cli-Mir-101-P2-v2  Cpi-Mir-101-P2-v1  Cpi-Mir-101-P2-v2  Cpo-Mir-101-P2-v1  Cpo-Mir-101-P2-v2  Dno-Mir-101-P2-v1  Dno-Mir-101-P2-v2  Dre-Mir-101-P2-v1  Dre-Mir-101-P2-v2  Ete-Mir-101-P2-v1  Ete-Mir-101-P2-v2  Gga-Mir-101-P2-v1  Gga-Mir-101-P2-v2  Hsa-Mir-101-P2-v1  Hsa-Mir-101-P2-v2  Mdo-Mir-101-P2-v1  Mdo-Mir-101-P2-v2  Mml-Mir-101-P2-v1  Mml-Mir-101-P2-v2  Mmu-Mir-101-P2-v1  Mmu-Mir-101-P2-v2  Oan-Mir-101-P2-v1  Oan-Mir-101-P2-v2  Ocu-Mir-101-P2-v1  Ocu-Mir-101-P2-v2  Rno-Mir-101-P2-v1  Rno-Mir-101-P2-v2  Sha-Mir-101-P2-v1  Sha-Mir-101-P2-v2  Tgu-Mir-101-P2-v1  Tgu-Mir-101-P2-v2  Xtr-Mir-101-P2-v1  Xtr-Mir-101-P2-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
BFAA01004869.1: 93867-93923 [+]
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50        
UGAAGGCCCAAGAUCUGA--|     C                    CG    UGUUUC 
AAGUUGUCAGAACACUACCG^     U                    A-    GAGAAC 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionNone
Get sequence