MirGeneDB

MirGeneDB ID

Rno-Mir-203-v1

Family name MIR-203 (all species)
Seed UGAAAUG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-203a
Paralogues Rno-Mir-203-v2 
Orthologues Aca-Mir-203-v1  Ami-Mir-203-v1  Bta-Mir-203-v1  Cfa-Mir-203-v1  Cpi-Mir-203-v1  Cpo-Mir-203-v1  Dno-Mir-203-v1  Ete-Mir-203-v1  Gga-Mir-203-v1  Hsa-Mir-203-v1  Mdo-Mir-203-v1  Mml-Mir-203-v1  Mmu-Mir-203-v1  Oan-Mir-203-v1  Sha-Mir-203-v1  Sto-Mir-203-v1  Tgu-Mir-203-v1  Xtr-Mir-203-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr6: 136704974-136705033 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-v1)
Mir-203-v1 chr6: 136704974-136705033 [+] UCSC Ensembl
Mir-203-v2 chr6: 136704974-136705033 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGCUUCUGUGUGCAGGCGCGCCUGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGCGCACGGCAGCGGCGACAGCAA
Get precursor sequence
Structure
        10          20        30        40        50          
AGAGCUUCUGUGUGCAG--|      U    C         U    G    A   UUCUGU 
                   GCGCGCC GGUC AGUGGUUCU AACA UUCA CAG      \
                   CGCGCGG CCAG UCACCAGGA UUGU AAGU GUU      A
AACGACAGCGGCGACGGCA^      C    A         U    A    -   AACGCG 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-203-v1_5p*

MirBase accessionMIMAT0017153
Sequence
0- AGUGGUUCUUAACAGUUCAACAG -23
Get sequence
Validated targets TargetScanVert: rno-miR-203a-5p
miRDB: MIMAT0017153
Mature sequence

Rno-Mir-203-v1_3p

MirBase accessionMIMAT0000876
Sequence
38- GUGAAAUGUUUAGGACCACUAG -60
Get sequence
Validated targets microrna.org: MIMAT0000876
TargetScanVert: rno-miR-203a-3p
miRDB: MIMAT0000876